Summary for ontology term: linseed oil food product

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTGCGCAGGCGGTCTCTTAAGTCTGTCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGACGGAAACTGGGAGACTGGAGTATCGGAGAGGAAAGCAGAATTCCTAGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCAGGTTAAGTGTGTTGTGAAATGTAGGCGCCCAACGTCTGAATTGCAGCGCATACTGTCCTGCTTGAGTGCGCGCAACGTTTGCGGAATTTGTCG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGCGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGGGAGCGCAGGTGGACGTATAGGTCCTTCTTAAAAGTTCGGGGCTCAGCCCCGTGAGGGGAAGGAAACCATGCGTCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTGGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGGCTTTTAAGTCCGACGTGAAAATGCGGGGCTTAACCCCGTATGGCGTTGGATACTGGAAGTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGAAAAGTCAGCGGTCAAAGTTCCGGGCTCAACCCGGTGACGCCGTTGAAACTTTCGTGCTGGAGTTCGTGCGAGGGAGGCGGAATGCGTTGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCAGGTTAAGTGTGTTGTGAAATGTAGGCGCCCAACGTCTGAATTGCAGCGCATACTGTCCTGCTTGAGTGCGCGCAACGTTTGCGGAATTTGTCG0.200000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGCGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGGGAGCGCAGGTGGACGTATAGGTCCTTCTTAAAAGTTCGGGGCTCAGCCCCGTGAGGGGAAGGAAACCATGCGTCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTGGT0.111111
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTGCGCAGGCGGTCTCTTAAGTCTGTCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGACGGAAACTGGGAGACTGGAGTATCGGAGAGGAAAGCAGAATTCCTAGT0.074074
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGGCTTTTAAGTCCGACGTGAAAATGCGGGGCTTAACCCCGTATGGCGTTGGATACTGGAAGTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.039216

Annotations:

common ontology terms
term enrichment score
TermScore
age 100 days0.666667
linseed oil food product0.500000
LOWER IN linseed oil food product0.500000
lamb0.400000
ireland0.333333
sheep0.166667
ovis aries0.142857
LOWER IN control diet0.117647
control diet0.117647
rumen0.083333
diet0.057143
farm0.052632
child0.050000
Fraction of dbbact annotations with this term covered by the query
TermScore
age 100 days0.500000
linseed oil food product0.500000
LOWER IN linseed oil food product0.500000
lamb0.250000
ireland0.200000
sheep0.090909
ovis aries0.076923
LOWER IN control diet0.066667
control diet0.066667
rumen0.043478
diet0.030303
farm0.027027
child0.025641
Fraction of annotations for the query sequences containing the term
TermScore
ovis aries1.000000
sheep1.000000
lamb1.000000
child1.000000
rumen1.000000
ireland1.000000
farm1.000000
age 100 days1.000000
diet0.500000
LOWER IN control diet0.500000
linseed oil food product0.500000
control diet0.500000
LOWER IN linseed oil food product0.500000

Problems / suggestions? Please email info AT dbbact DOT org