Summary for ontology term: loggerhead sea turtle

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAGCGATGAAGGCTTTCGAGTCGTAAAGCTCTGTCCTTGGGGAAGAAAAAAATGACGGTACCCTTGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGATTTCGGTCTGTAAAACTCTGTTGTTTATGACGAACGTGCAGTGTGTGAATAATGCATTGCAATGACGGTAGTAAACGAGGAAGCCACGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTCGCGTGAAGGATGAAGGTCTTATGGATTGTAAACTTCTTTTATACGGGAATAAAAAGAGCCACGTGTGGCTTATTGCATGTACCGTATGAATAAGGATCGGCTAACT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCAACGCCGCGTGAGCGATGAAGGTCTTCGGATCGTAAAGCTCTGTCTTTAGGGATGATAATGACAGTACCTAAGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGTGATGAATGCCTTCGGGTTGTAAAGCTCTGTCATTTGGGACGATAATGACGGTACCAAATGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGAATATTGGGCAATGGGCGAAAGCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGCTTTCGGGTTGTAAACTTCTTTTAGCAGGGACGAAACAAATGACGGTACCTGCAGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCG0.666667
d__BacteriaTGGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGAATGAAGAAGGCCTTAGGGTTGTAAAGTTCTGTTTACGGGGACGATAATGACGGTACCCGTGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTCTTCGGGGACGATAATGACGGTACCCGAGGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.571429
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAGTCAGTGACGGTACCAACAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGC0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGCAAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTGTAAGGGGAGAATAAGGATTACGTGTAATTCGATGACTGTACTTTACGAATAAGCATCGGCTAACT0.400000

Annotations:

common ontology terms
term enrichment score
TermScore
adriatic sea coastal waters of italy0.666667
caretta caretta0.666667
loggerhead sea turtle0.666667
mediterranean sea0.285714
italy0.095238
research facility0.013514
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
adriatic sea coastal waters of italy0.500000
caretta caretta0.500000
loggerhead sea turtle0.500000
mediterranean sea0.166667
italy0.050000
research facility0.006803
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
research facility1.000000
mediterranean sea1.000000
italy1.000000
adriatic sea coastal waters of italy1.000000
caretta caretta1.000000
loggerhead sea turtle1.000000

Problems / suggestions? Please email info AT dbbact DOT org