Summary for ontology term: los angeles district

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.142857
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCATAAAGTGGGCGGAATTCGTGG0.137931
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGTAGGCGGGGTTGTAAGTCAGATGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTACAACTCTGGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.133333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.133333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGTCTGGTAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGCCAGACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.125000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAGCTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.117647
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTACAGAAGAGGACAGTGGAACTCCATG0.105263
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGAGTAGGCGGTTATGCAAGTCATATGTGAAATTCTGGGGCTCAACTTCAGAGCTGCATAAGAAACTGTGTAACTAGAGTACAGGAGAGGTAAGCGGAATTCCTAG0.105263

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
los angeles district0.500000
LOWER IN 6-month-old human stage0.500000
hispanic0.333333
hispanic or latin american0.250000
breast fed0.250000
LOWER IN formula fed0.250000
formula fed0.200000
LOWER IN breast fed0.200000
6-month-old human stage0.166667
LOWER IN 1-month-old human stage0.166667
1-month-old human stage0.125000
state of california0.032258
infant0.029412
homo sapiens0.003096
feces0.002611
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
infant1.000000
state of california1.000000
hispanic or latin american1.000000
los angeles district1.000000
hispanic1.000000
6-month-old human stage0.583333
formula fed0.416667
1-month-old human stage0.416667
breast fed0.416667
LOWER IN 6-month-old human stage0.083333
LOWER IN 1-month-old human stage0.083333
LOWER IN breast fed0.083333
LOWER IN formula fed0.083333
Number of experiments associating the term to the sequence
TermScore
feces1.000000
homo sapiens1.000000
infant1.000000
state of california1.000000
formula fed1.000000
hispanic or latin american1.000000
los angeles district1.000000
hispanic1.000000
6-month-old human stage1.000000
1-month-old human stage1.000000
LOWER IN 6-month-old human stage1.000000
LOWER IN 1-month-old human stage1.000000
LOWER IN breast fed1.000000
breast fed1.000000
LOWER IN formula fed1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v41 / 8approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 10approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 13approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 13approvedNo
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 17approvedNo
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 17approvedNo
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 21approvedNo
859amnon high in breast fed compared to formula fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v41 / 22approvedNo
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v41 / 22approvedNo
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v41 / 25approvedNo
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v41 / 41approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v41 / 72approvedNo

Problems / suggestions? Please email info AT dbbact DOT org