Summary for ontology term: low bmi

Number of annotations with term: 20

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.384615
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGTCGGAGAGGCAATCGGAATTCCGTG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCCGAGCAAGTCAGTTGTGAAAACTATGGGCTTAACCCATAACGTGCAATTGAAACTGTCCGGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGAGCTCAACTCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.307692
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGACGGTTTATTAAGTCCAGAATTAAAGCCCGAGGCTTAACCTCGGTTCGTTCTGGATACTGGTAGACTAGAGTATGGTAGAGGCAAATGGAATTCCTAGT0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATATCAAGTCAGAAGTGAAAATTACGGGCTCAACTCGTAACCTGCTTTTGAAACTGACATTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.307692
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATAATTGGGCGTAAAGGGCGCGTAGGCGGCTCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAATGCAAGTCAGATGTGAAATCCATGGGCTTAACCCATGAACTGCATTTGAAACTGTATTTCTTGAGTACTGGAGAGGCAATCGGAATTCCTAG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATACAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTATCTCTTGAGTGTCGGAGAGGTAGACGGAATTCCTAG0.307692

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCATCGCAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGTGAAGCTCGAGTGTCGGAGAGGAAAGCGGAATTCCTAGT0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.444444
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGGCTTTTAAGTCTGACGTGAAAATGCGGGGCTTAACCCCGTATGGCGTTGGATACTGGAAGTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTCTGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGAGGCAAGTTGAATGTCTAAACTATCGGCTCAACTGATAGTCGCGTTCAAAACTGCCACTCTTGAGTGCAGTAGAGGTAGGCGGAATTCCTAGT0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.333333
d__BacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTTTTGTAAGTCAGAGGTGTAATCCCACGGCTTAACCGTGGAACTGCCTTTGATACTGCATAACTTGGATCCGGGAGAGGACAGCGGAATTCCAGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTCATCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTC0.352941
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__OdoribacterTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTTAGTGGTTAAATATTTGAGCTAAACTCAATTGTGCCATTAATACTGGTAAACTGGAGTACAGACGAGGTAGGCGGAATAAGTTAC0.315789
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGAGCTCAACTCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.250000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAATAAGTTAGTTGTGAAAGCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTGTTTTTCTTGAGTACTGGAGAGGAAAGTGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGACGGTTTATTAAGTCCAGAATTAAAGCCCGAGGCTTAACCTCGGTTCGTTCTGGATACTGGTAGACTAGAGTATGGTAGAGGCAAATGGAATTCCTAGT0.222222
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGCGGTTTCGTAAGTTAGAAGTGTAATCCCGGGGCTTAACCCCGGAGCTACTTCTAAGACTGCGGGACTTGAGTGTGGGAGAGGTAAGTGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTCGGCAAGTCAGATGTGAAATCTGGAGGCTCAACCTCCAAACTGCATTTGAAACTGCTGATCTTGAGTATCGGAGAGGTAATCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAGGTCAGATGTGAAATGCCGGGGCTTAACCCCGGAGCTGCATTTGAAACCGTAGTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.222222
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTTTTAAGTTAGAAGTGGAAGTCCTGCTTTTAAGGTGGGAATTGCTTTTAATACTGGAAGGCTTGAGTGCAGAAGAGGTAAGTGGAATTCCCAG0.210526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGTGCAAGTTGAATGTTTAATCTATGGGCTCAACCCATATCAGCGTTCAAAACTGCATTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCTAGT0.206897

Annotations:

common ontology terms
term enrichment score
TermScore
low bmi0.716418
LOWER IN low bmi0.551724
LOWER IN high bmi0.484848
high bmi0.484848
body mass index0.328767
obesity0.148148
hispanic or latin american0.142857
switzerland0.142857
LOWER IN body mass index0.129032
thailand0.125000
colombia0.117647
poland0.111111
state of new york0.090909
lean body mass0.086957
LOWER IN lean body mass0.086957
obese body mass index status0.083333
LOWER IN obese body mass index status0.083333
LOWER IN obesity0.074074
city0.066667
adult0.066482
united kingdom0.060606
homo sapiens0.057348
feces0.049689
united states of america0.031128
Fraction of dbbact annotations with this term covered by the query
TermScore
low bmi0.888889
LOWER IN low bmi0.888889
LOWER IN high bmi0.615385
high bmi0.615385
body mass index0.363636
lean body mass0.333333
LOWER IN lean body mass0.333333
obesity0.285714
hispanic or latin american0.250000
obese body mass index status0.250000
LOWER IN obese body mass index status0.250000
LOWER IN body mass index0.181818
thailand0.166667
colombia0.142857
LOWER IN obesity0.142857
switzerland0.111111
state of new york0.083333
poland0.076923
city0.050000
united kingdom0.043478
adult0.034682
homo sapiens0.029520
feces0.025478
united states of america0.016194
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
adult0.800000
low bmi0.600000
LOWER IN high bmi0.400000
united states of america0.400000
high bmi0.400000
LOWER IN low bmi0.400000
body mass index0.300000
poland0.200000
switzerland0.200000
united kingdom0.100000
state of new york0.100000
LOWER IN body mass index0.100000
city0.100000
colombia0.100000
obesity0.100000
hispanic or latin american0.100000
thailand0.100000
lean body mass0.050000
LOWER IN lean body mass0.050000
obese body mass index status0.050000
LOWER IN obesity0.050000
LOWER IN obese body mass index status0.050000
Exp. ID User ID Description Date Region Flag Sequences
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 6
644amnonpositively correalted with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 7
404amnon high in high bmi obesity compared to lean body mass low bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 14
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
663amnon high in low bmi compared to obesity obese body mass index status high bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 21
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 29
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
663amnon high in obesity obese body mass index status high bmi compared to low bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 44
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 70
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
404amnon high in lean body mass low bmi compared to high bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 84
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345

Problems / suggestions? Please email info AT dbbact DOT org