Summary for ontology term: low fiber

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__FirmicutesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGTGTAGGCGGGAATTTAAGTAAGGTGTGAAAACTCCGGGCTTAACCTGGAGACTGCACTTTAAACTGGATTTCTTGAGGGCAGGAGAGGAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTATGGAGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGCAAGTTAAATCCGGGGGCTCAACCCCCGTCCGCTTCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__EisenbergiellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAACCCAGGGCTCAACCTTGGGATTGCATTTGGAACTGCCAGGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAGGCAAGTTGGATGTGAAAACTGTGGGCTCAACCTACAGACTGCATTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCGAGGCAAGTCAGGCGTGAAATCTATGGGCTTAACCCATAAACTGCGCTTGAAACTGTCTTGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AcetanaerobacteriumTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAATGCAAGTTGAATGTTTAAACTATCGGCTCAACTGATAATCGCGTTCAAAACTGCATTTCTTGAGTGGAGTAGAGGCAGGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGAAGCAAGTCAGGTGTGAAATCTATGGGCTCAACCCATAAACTGCACTTGAAACTGTTTTTCTTGAGTGATGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAATTAAGTTAGTTGTGAAATCCCACGGCTCAACTGTGGAACTGCAACTAAAACTGATTTTCTTGAGTACTGGAGAGGAAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATAATTGGGCGTAAAGGGCGCGTAGGCGGCTCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.500000
d__BacteriaTACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTCCGACAAGTCAGGGGTGAAAGCCCGGCGCCCAACGCCGGAACCGCCTTTGATACTGCCGGGCTGGAATGCGGATGCCGTGGGAGGAATGAGTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGGAAGGTCCGGGTGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACTGCCTGTCAAGCGTGCAGTGAAACGCCGCGGCCCAACCGCGGCCCTGCTGCGCGAACTGGCGGGCTTGAGTGGGCTGCAGGCACGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCAGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGACTTACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTGTAAGCCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGTAGGCGGCTTGTTAAGTATGAAATTAAAGCCCGGGGCTTAACTCCGGTTCGTTTCATAAACTGGCTAGCTTGAGTATGGAAGAGGTAAACGGAATTTCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGACAAGTTGGAAGTGAAACCCACGGGCTCAACTCGTGAACTGCTTTCAAAACTGTTTTTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCTGTGCAAGTCAGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTCTTGAAACTGCGCGGCTTGAGTGCAGGAGGGGCAGGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeCACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGCAGGCGGCCGCCTAAGCGGGACCTCTAATCCTGGGGCTCAACCTCAGGCCGGGTCCCGAACTGGGCGGCTCGGGTGCGGTAGGGGTAGGCGGAATTCCCGGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTATGGAGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGCAAGTTAAATCCGGGGGCTCAACCCCCGTCCGCTTCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGAAGCAAGTCAGGTGTGAAATCTATGGGCTCAACCCATAAACTGCACTTGAAACTGTTTTTCTTGAGTGATGGAGAGGCAAGCGGAATTCCTAG0.285714
d__BacteriaTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTAATATAAGTTGGAGTTTTAAACCATGGGCTCAACCCATGTCAGGCTCCAAAACTGTATAACTTGAGTACTGGAGAGGAAAGTGGAATTCCTAGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAATACCGGGGCTTAACCCCGGGGCTGCATTTGAAACTGCGGTTCTTGAGTGCGGGAGAGGAAAGCGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTTGTCAAGTCGAATGTGAAATACCGGGGCTCAACCCCGGGGCTGCATTCGAAACTGGCAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGAAATGCAAGTCAGTTGTGAAAGGCAGAGGCTCAACCTCTGTAAGCAATTGAAACTGTATTTCTTGAGATGTGGAGAGGCAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__MurdochiellaTACGTAGGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTTTGTTAAGTTTGGCGTTAAATCACGGGGCTCAACCCCGTTCAGCGTTGAAAACTGGCAAACTTGAGTAGTAGAGGGGACAGTGGAATTCCTAGT0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AcetanaerobacteriumTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAATGCAAGTTGAATGTTTAAACTATCGGCTCAACTGATAATCGCGTTCAAAACTGCATTTCTTGAGTGGAGTAGAGGCAGGCGGAATTCCTAGT0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGCAATGCAAGTCAGATGTAAAAGGCAAAGGCTCAACCTTTGTAAGCATCTGAAACTGTATAGCTTGAGAAGTGTAGAGGCAAGTGGAATTTTTAGT0.095238

Annotations:

common ontology terms
term enrichment score
TermScore
high filber0.500000
LOWER IN low fiber0.500000
low fiber0.500000
plant fiber cell0.400000
LOWER IN plant fiber cell0.400000
colombia0.250000
LOWER IN high fiber0.250000
city0.095238
adult0.011494
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
high filber0.500000
LOWER IN low fiber0.500000
low fiber0.500000
plant fiber cell0.333333
LOWER IN plant fiber cell0.333333
LOWER IN high fiber0.166667
colombia0.142857
city0.050000
adult0.005780
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
city1.000000
adult1.000000
colombia1.000000
plant fiber cell0.500000
high filber0.500000
LOWER IN low fiber0.500000
low fiber0.500000
LOWER IN high fiber0.500000
LOWER IN plant fiber cell0.500000

Problems / suggestions? Please email info AT dbbact DOT org