Summary for ontology term: low milk yield

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCCTTTAAGCCAGCGGTCAAATGTCATGGCCCAACCTTGGCATGCCGTTGGAACTGGTGGCCTTGAATACACACAAGGAAGGTGGAATTCGTCGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCTCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTTTTACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGTTTTTTAAGCGTGACGTGAAATGTAGGGGCTCAACCTGTGCAGTGCGTCGCGAACTGGAGAACTTGAGTGCACTCGAGGAAGGCGGAATTTGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGCGGCAAGTCAGAAGTGAAAATTATGGGCTCAACTCATAACCTGCTTTTGAAACTGTTGCTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGTTAAGTCAGCGGTGAAATGTCCCGGCTCAACCGGGGAGCTGCCGTTGATACTGGCGTGCTGGAGAGCGGACGGCGCCGGCGGAATGAGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGATTGCAAGTCAGGTGTGAAATACATGGGCTCAACCCATGGGCTGCACTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGGAAGGTCCTGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGGCGTTTAAGCGTGCTGTGAAATGCCGCGGCTCAACCGTGGAAGTGCAGCGCGAACTGGATGTCTTGAGTGAGTACGACGCGGACGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCCGAGTAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTACTTGGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCTG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGCCTTTTAAGCGTGACGTGAAATGCAGGTGCTCAACATCTGAGCTGCGTCGCGAACTGGAGGGCTTGAGTGAGTTCGATGTCAGCGGAATTCGTGG0.500000
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGGTTGTTAAGCGTGACGTGAAATGTAGCCGCTCAACGGCTGCACTGCGTCGCGAACTGGCAGTCTTGAGTGAGTACGACGCGGACGGAATTCGTGG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTTGCAAGTCTGAAGTGAAAACCCTGGGCTCAACCCTGGGATTGCTTTGGAAACTGTAGGACTGGAGTGTCGGAGGGGCATGTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATAGAAACTATTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTACGTAGGTGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCATGTAGGCGGGCTTTTAAGTCCGACGTGAAAATGCGGGGCTTAACCCCGTATTGCGTTGGATACTGGGAGTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCATAAAGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACTGCAAGTCAGGTGTGAAATGTAGGGGCTTAACCCCTACCCTGCACTTGAAACTGTGGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGGGGGGTGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTATGTTAAGTCTGGTGTTAAATTCCGAAGCTCAACTTCGGTACGGCACTGGATACTGGCAAACTTGAATGCGGTAGAGGTAAAGGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATTGCAAGTCAGGTGTGAAATGCGGGGGCTCAACCCCCGAACTGCACTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTTTTGTAAGTCAGAGGTGTAATCCCACGGCTTAACCGTGGAACTGCCTTTGATACTGCATAACTTGGATCCGGGAGAGGACAGCGGAATTCCAGG0.500000
d__BacteriaTACGGGGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGCGGTTTATTAAGTTTGGTGTTAAATATTGAGGCTTAACTTCAACACGGCATCGGATACTGGTAGACTGGAATGCGGTAGAGGTAAAGGGAATTTCTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAGGTAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATAGAAACTATCATTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCAGTTCAAGTCAGCGGTCAAAATTCGGGGCTCAACCCCGTCTCGCCGTTGAAACTGTGCTGCTCGAGTTCGTGCGAGGATGGCGGAATGCGCGGT0.500000
d__BacteriaCACGTAAGGTGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCATGTAGGCGGCCGCGCAAGTCTGGAGTGAAATGCCGAAGCTTAACTTCGGAACTGCTTTGGAAACTGCGTGGCTGGAGTCACCGAGGCGGAGCCGGAATTCCAGG0.500000
d__Bacteria;p__"Tenericutes";c__Mollicutes;o__Anaeroplasmatales;f__Anaeroplasmataceae;g__AnaeroplasmaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGCAGATGGCACATTAAGTTTCTTGTAAAAATGCTAGGCTCAACCTAGTAGGGCAAGAGATACTGATGAGCTAGAGTACGAGAGAGGCAAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGAGGAAGTCAGATGTGGAAGCGATGGGCATAACCCATGGAGTGCATTTGAAACTCCTTGTCTAGAGTACTGGAGGGGTGAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCTGAAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTCTGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCTGCGGTTAAATGTCAGTGCCCAACGCTGGCATGCCGTGGAAACTGGGTGTCTTGAATGTGCACAAGGAAGGTGGAATTCGTGGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACTTTGGGCTCAACCCGGAGACTGCTTTTGAAACTGTCATACTGGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTAGGTTAAGCGTGTTGTGAAATGTAGTCGCTCAACGGGTGCACTGCAGCGCGAACTGGCTTACTTGAGTGCGCGGAAAGTCGGCGGAATTCGTTG0.400000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGCCCCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTATGCAAGCTTGGTGTGAAATGCCGGGGCTTAACTCCGGCACTGCGTTGAGAACTGCAAAACTAGAGTAACTGAGGGGCAGCCGGAATTCCAGG0.400000
d__BacteriaCACGTAAGCCTCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTGCTGCAAGCCAGGCGTGAAATACCGGGGCTTAACTCCGGAACTGCGCTTGGAACTGCAGTGCTTGAGTCACTGAGGGGGAGCCGGAATTCCAGG0.400000

Annotations:

common ontology terms
term enrichment score
TermScore
LOWER IN high milk yield0.500000
low milk yield0.500000
LOWER IN low milk yield0.500000
high milk yield0.500000
holstein dairy cow0.400000
shandong province0.333333
rumen liquid0.333333
bos taurus0.105263
rumen0.083333
research facility0.012270
china0.010753
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN high milk yield0.500000
low milk yield0.500000
LOWER IN low milk yield0.500000
high milk yield0.500000
holstein dairy cow0.250000
shandong province0.200000
rumen liquid0.200000
bos taurus0.055556
rumen0.043478
research facility0.006173
china0.005405
Fraction of annotations for the query sequences containing the term
TermScore
holstein dairy cow1.000000
bos taurus1.000000
shandong province1.000000
research facility1.000000
china1.000000
rumen liquid1.000000
rumen1.000000
LOWER IN high milk yield0.500000
low milk yield0.500000
LOWER IN low milk yield0.500000
high milk yield0.500000

Problems / suggestions? Please email info AT dbbact DOT org