Summary for ontology term: macaca mulatta

Number of annotations with term: 62

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTCAAAGGCTGTGGCTCAACCATAGTTTGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.494624
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATGCTAAGGCTTAACCATAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.477273
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTTTTAAGCGTGTTGTGAAATGTAGGTGCTCAACATCTGCACTGCAGCGCGAACTGGAGGGCTTGAGTACGCACAACGTGGGCGGAATTCGTGG0.447059
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGAAGACTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.418605
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGTTGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.412371
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.409091
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTCTTTAAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGAAGGACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.404762
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGCAGGCGGGATAGCAAGTCAGATGTGAAATGCTATGGCTTAACCATAGAACTGCATTTGAAACTGCTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.404494
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGACCCTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCACCGCAGCGCGAACTGGGGGTCTTGAGTTCACGGGAGGAAGGCGGAATTCGTGG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.381679

Annotations:

common ontology terms
term enrichment score
TermScore
macaca mulatta1.000000
puerto rico0.622222
rhesus macaque0.436364
cayo santiago0.367347
indian rhesus macaque0.367347
monkey0.321716
age 8 months0.162162
age > 1 year0.162162
age 10-15 years0.162162
age < 1 year0.150000
state of washington0.139535
age 12-23 years0.138889
rectal swab0.130435
age 1-7 years0.129870
age 1 month0.129870
macaque0.117647
3-month-old human stage0.115385
adult organism0.109091
mouth mucosa0.103448
subgingival plaque0.099010
captive0.097166
LOWER IN state of oregon0.093023
state of oregon0.093023
neonate0.092308
age 6 months0.088235
penis0.084507
oral cavity0.082192
age 1 week0.081081
juvenile organism0.075000
dentition0.068493
male organism0.067416
vagina0.063158
LOWER IN age 8 months0.060606
induced periodontitis0.060606
LOWER IN induced periodontitis0.060606
LOWER IN age 10-15 years0.060606
female organism0.059406
LOWER IN age &lt; 1 year0.058824
periodontitis0.057143
LOWER IN periodontitis0.057143
state of tennessee0.055556
infant0.055046
LOWER IN 3-month-old human stage0.052632
research facility0.052320
LOWER IN adult organism0.051282
state of california0.048193
LOWER IN state of california0.048193
zoological garden0.043478
child0.041322
LOWER IN infant0.035088
LOWER IN neonate0.031746
united states of america0.031460
LOWER IN age 6 months0.031250
LOWER IN age 12-23 years0.031250
feces0.031080
LOWER IN age 1-7 years0.030769
LOWER IN penis0.030769
LOWER IN age 1 month0.030769
LOWER IN age 1 week0.030303
LOWER IN juvenile organism0.029412
LOWER IN male organism0.028169
LOWER IN vagina0.027397
LOWER IN female organism0.026667
female0.026525
adult0.021575
LOWER IN child0.020408
LOWER IN adult0.017021
LOWER IN female0.016000
LOWER IN control0.009259
control0.009259
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
macaca mulatta1.000000
puerto rico1.000000
neonate1.000000
LOWER IN neonate1.000000
macaque0.666667
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
age > 1 year0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
LOWER IN age 10-15 years0.500000
age 10-15 years0.500000
age 1-7 years0.333333
LOWER IN age 1-7 years0.333333
LOWER IN penis0.333333
penis0.333333
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
age 1 month0.333333
LOWER IN age 1 month0.333333
periodontitis0.250000
LOWER IN periodontitis0.250000
state of washington0.250000
age 1 week0.250000
LOWER IN age 1 week0.250000
monkey0.214286
state of tennessee0.200000
rectal swab0.200000
juvenile organism0.166667
LOWER IN juvenile organism0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
3-month-old human stage0.142857
LOWER IN 3-month-old human stage0.142857
LOWER IN adult organism0.125000
adult organism0.125000
LOWER IN male organism0.111111
male organism0.111111
mouth mucosa0.111111
vagina0.090909
LOWER IN vagina0.090909
female organism0.076923
LOWER IN female organism0.076923
subgingival plaque0.071429
oral cavity0.071429
zoological garden0.066667
captive0.055556
dentition0.043478
infant0.038462
LOWER IN infant0.038462
state of california0.038462
LOWER IN state of california0.038462
child0.027778
LOWER IN child0.027778
research facility0.027211
united states of america0.016194
feces0.015924
female0.015873
LOWER IN female0.015873
adult0.011561
LOWER IN adult0.011561
LOWER IN control0.005405
control0.005405
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of annotations for the query sequences containing the term
TermScore
macaca mulatta1.000000
research facility0.677419
feces0.645161
monkey0.645161
united states of america0.548387
puerto rico0.451613
captive0.387097
rhesus macaque0.387097
cayo santiago0.290323
indian rhesus macaque0.290323
dentition0.161290
adult0.161290
subgingival plaque0.161290
3-month-old human stage0.096774
age 8 months0.096774
age > 1 year0.096774
infant0.096774
age < 1 year0.096774
oral cavity0.096774
mouth mucosa0.096774
age 10-15 years0.096774
adult organism0.096774
rectal swab0.096774
state of washington0.096774
age 12-23 years0.080645
child0.080645
age 1-7 years0.080645
age 1 month0.080645
female0.080645
macaque0.064516
state of california0.064516
LOWER IN state of oregon0.064516
state of oregon0.064516
LOWER IN state of california0.064516
age 6 months0.048387
vagina0.048387
female organism0.048387
penis0.048387
male organism0.048387
juvenile organism0.048387
age 20 months0.048387
age 1 week0.048387
neonate0.048387
LOWER IN age 8 months0.032258
LOWER IN 3-month-old human stage0.032258
LOWER IN adult0.032258
induced periodontitis0.032258
periodontitis0.032258
LOWER IN control0.032258
control0.032258
LOWER IN induced periodontitis0.032258
LOWER IN periodontitis0.032258
state of tennessee0.032258
zoological garden0.032258
LOWER IN age 10-15 years0.032258
LOWER IN adult organism0.032258
LOWER IN infant0.032258
LOWER IN age &lt; 1 year0.032258
LOWER IN age 6 months0.016129
LOWER IN age 12-23 years0.016129
LOWER IN child0.016129
LOWER IN age 1-7 years0.016129
LOWER IN penis0.016129
LOWER IN male organism0.016129
LOWER IN age 1 week0.016129
LOWER IN neonate0.016129
LOWER IN juvenile organism0.016129
LOWER IN age 20 months0.016129
LOWER IN vagina0.016129
LOWER IN female organism0.016129
LOWER IN female0.016129
LOWER IN age 1 month0.016129
Exp. ID User ID Description Date Region Flag Sequences
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
770amnondominant macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
876amnondominant feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 14
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
770amnondominant oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
876amnoncommon feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 30
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065

Problems / suggestions? Please email info AT dbbact DOT org