Summary for ontology term: macaca mulatta

Number of annotations with term: 64

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTCAAAGGCTGTGGCTCAACCATAGTTTGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.484211
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATGCTAAGGCTTAACCATAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.483516
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTTTTAAGCGTGTTGTGAAATGTAGGTGCTCAACATCTGCACTGCAGCGCGAACTGGAGGGCTTGAGTACGCACAACGTGGGCGGAATTCGTGG0.431818
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTTCTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGAAGACTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.422222
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGCAGGCGGGATAGCAAGTCAGATGTGAAATGCTATGGCTTAACCATAGAACTGCATTTGAAACTGCTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.413043
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGTTGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTCTTTAAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGAAGGACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.395349
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGACCCTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCACCGCAGCGCGAACTGGGGGTCTTGAGTTCACGGGAGGAAGGCGGAATTCGTGG0.390244
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTCTTATAAGCGTGACGTGAAATGCAGCGGCTCAACCGTATGATGTGCGTCGCGAACTGTAGGACTTGAGTGTATTCGATGTCAGCGGAATTTGTG0.373832

Annotations:

common ontology terms
term enrichment score
TermScore
macaca mulatta0.933333
rhesus macaque0.504854
puerto rico0.417910
indian rhesus macaque0.360000
cayo santiago0.360000
monkey0.332016
age 8 months0.157895
age 10-15 years0.157895
age > 1 year0.157895
age < 1 year0.146341
age 12-23 years0.135135
age 1-7 years0.126582
age 1 month0.126582
captive0.117914
3-month-old human stage0.113208
state of washington0.113208
macaque0.111111
LOWER IN state of california0.111111
LOWER IN state of oregon0.111111
rectal swab0.096774
mouth mucosa0.096774
state of oregon0.086957
age 6 months0.085714
age 20 months0.085714
neonate0.085714
penis0.082192
subgingival plaque0.078740
age 1 week0.073171
juvenile organism0.070588
adult organism0.069767
oral cavity0.067416
dentition0.065789
LOWER IN age 8 months0.058824
induced periodontitis0.058824
LOWER IN induced periodontitis0.058824
bethesda0.058824
LOWER IN age 10-15 years0.058824
LOWER IN age &lt; 1 year0.058824
male organism0.056604
vagina0.056604
state of maryland0.055556
state of tennessee0.054054
research facility0.053685
LOWER IN 3-month-old human stage0.052632
LOWER IN adult organism0.052632
female organism0.050847
LOWER IN periodontitis0.045455
LOWER IN adult0.044944
infant0.044776
LOWER IN infant0.044444
state of california0.042553
periodontitis0.041667
zoological garden0.040816
united states of america0.034377
child0.034014
feces0.030601
LOWER IN age 6 months0.030303
LOWER IN age 12-23 years0.030303
LOWER IN penis0.030303
LOWER IN neonate0.030303
LOWER IN age 20 months0.030303
LOWER IN age 1 month0.030303
LOWER IN vagina0.029851
LOWER IN age 1-7 years0.029851
LOWER IN juvenile organism0.029851
LOWER IN age 1 week0.028986
LOWER IN male organism0.028571
LOWER IN female organism0.027778
LOWER IN child0.025641
female0.024155
LOWER IN female0.022727
adult0.018282
LOWER IN control0.008772
control0.008584
Fraction of dbbact annotations with this term covered by the query
TermScore
macaca mulatta0.875000
rhesus macaque0.666667
LOWER IN age 8 months0.500000
age 6 months0.500000
LOWER IN age 6 months0.500000
age 8 months0.500000
macaque0.500000
age 10-15 years0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
age > 1 year0.500000
LOWER IN state of california0.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
bethesda0.500000
LOWER IN age 10-15 years0.500000
LOWER IN age &lt; 1 year0.500000
age 20 months0.500000
LOWER IN penis0.500000
neonate0.500000
LOWER IN neonate0.500000
LOWER IN age 20 months0.500000
LOWER IN state of oregon0.500000
LOWER IN age 1 month0.500000
puerto rico0.400000
LOWER IN vagina0.333333
penis0.333333
age 1-7 years0.333333
LOWER IN age 1-7 years0.333333
age < 1 year0.333333
LOWER IN juvenile organism0.333333
age 1 month0.333333
state of maryland0.250000
monkey0.222222
state of tennessee0.200000
LOWER IN age 1 week0.200000
LOWER IN 3-month-old human stage0.166667
LOWER IN adult organism0.166667
LOWER IN male organism0.166667
age 1 week0.166667
3-month-old human stage0.142857
state of oregon0.142857
juvenile organism0.142857
state of washington0.142857
LOWER IN female organism0.125000
rectal swab0.100000
mouth mucosa0.100000
LOWER IN periodontitis0.083333
LOWER IN adult0.080000
LOWER IN infant0.076923
male organism0.071429
LOWER IN child0.071429
vagina0.071429
captive0.068966
periodontitis0.062500
zoological garden0.058824
adult organism0.055556
female organism0.055556
subgingival plaque0.052632
oral cavity0.052632
dentition0.041667
LOWER IN female0.041667
state of california0.032258
infant0.029412
research facility0.027933
child0.021739
united states of america0.017730
feces0.015666
female0.014286
adult0.009709
LOWER IN control0.005102
control0.004975
Fraction of annotations for the query sequences containing the term
TermScore
macaca mulatta1.000000
research facility0.687500
monkey0.656250
feces0.656250
united states of america0.562500
puerto rico0.437500
rhesus macaque0.406250
captive0.406250
indian rhesus macaque0.281250
cayo santiago0.281250
adult0.156250
subgingival plaque0.156250
dentition0.156250
3-month-old human stage0.093750
age 8 months0.093750
age 10-15 years0.093750
adult organism0.093750
rectal swab0.093750
age > 1 year0.093750
mouth mucosa0.093750
oral cavity0.093750
age < 1 year0.093750
infant0.093750
state of washington0.093750
female0.078125
age 12-23 years0.078125
child0.078125
age 1-7 years0.078125
age 1 month0.078125
macaque0.062500
LOWER IN state of california0.062500
state of oregon0.062500
LOWER IN state of oregon0.062500
state of california0.062500
age 6 months0.046875
penis0.046875
male organism0.046875
age 20 months0.046875
juvenile organism0.046875
vagina0.046875
female organism0.046875
age 1 week0.046875
neonate0.046875
LOWER IN age 8 months0.031250
LOWER IN 3-month-old human stage0.031250
zoological garden0.031250
state of tennessee0.031250
LOWER IN adult0.031250
induced periodontitis0.031250
LOWER IN control0.031250
periodontitis0.031250
control0.031250
LOWER IN induced periodontitis0.031250
LOWER IN periodontitis0.031250
bethesda0.031250
state of maryland0.031250
LOWER IN age 10-15 years0.031250
LOWER IN adult organism0.031250
LOWER IN age &lt; 1 year0.031250
LOWER IN infant0.031250
LOWER IN age 6 months0.015625
LOWER IN vagina0.015625
LOWER IN female organism0.015625
LOWER IN age 12-23 years0.015625
LOWER IN child0.015625
LOWER IN age 1-7 years0.015625
LOWER IN male organism0.015625
LOWER IN penis0.015625
LOWER IN age 1 week0.015625
LOWER IN neonate0.015625
LOWER IN age 20 months0.015625
LOWER IN juvenile organism0.015625
LOWER IN female0.015625
LOWER IN age 1 month0.015625
Number of experiments associating the term to the sequence
TermScore
macaca mulatta7.000000
feces6.000000
united states of america5.000000
research facility5.000000
monkey4.000000
rhesus macaque2.000000
captive2.000000
macaque2.000000
puerto rico2.000000
adult2.000000
LOWER IN adult2.000000
3-month-old human stage1.000000
LOWER IN age 8 months1.000000
age 6 months1.000000
LOWER IN 3-month-old human stage1.000000
LOWER IN age 6 months1.000000
age 8 months1.000000
zoological garden1.000000
state of tennessee1.000000
age 10-15 years1.000000
adult organism1.000000
rectal swab1.000000
indian rhesus macaque1.000000
cayo santiago1.000000
LOWER IN vagina1.000000
LOWER IN female organism1.000000
penis1.000000
male organism1.000000
age > 1 year1.000000
LOWER IN state of california1.000000
state of oregon1.000000
female1.000000
subgingival plaque1.000000
dentition1.000000
age 12-23 years1.000000
child1.000000
age 1-7 years1.000000
LOWER IN age 12-23 years1.000000
LOWER IN child1.000000
LOWER IN age 1-7 years1.000000
induced periodontitis1.000000
LOWER IN control1.000000
periodontitis1.000000
control1.000000
LOWER IN induced periodontitis1.000000
LOWER IN periodontitis1.000000
bethesda1.000000
state of maryland1.000000
LOWER IN age 10-15 years1.000000
mouth mucosa1.000000
oral cavity1.000000
age < 1 year1.000000
infant1.000000
LOWER IN adult organism1.000000
LOWER IN age &lt; 1 year1.000000
LOWER IN infant1.000000
age 20 months1.000000
juvenile organism1.000000
state of washington1.000000
LOWER IN male organism1.000000
LOWER IN penis1.000000
vagina1.000000
female organism1.000000
age 1 week1.000000
neonate1.000000
LOWER IN age 1 week1.000000
LOWER IN neonate1.000000
LOWER IN age 20 months1.000000
LOWER IN juvenile organism1.000000
age 1 month1.000000
LOWER IN state of oregon1.000000
state of california1.000000
LOWER IN female1.000000
LOWER IN age 1 month1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
1006amnondominant feces, monkey, captive, united states of america, state of maryland, research facility, bethesda, macaca mulatta, rhesus macaque2023-01-09v41 / 9approvedNo
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v41 / 11approvedNo
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v11 / 12approvedNo
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 14approvedNo
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v41 / 14approvedNo
770amnondominant male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 14approvedNo
770amnondominant vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 14approvedNo
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 14approvedNo
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v41 / 15approvedNo
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 15approvedNo
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 15approvedNo
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v41 / 17approvedNo
770amnondominant age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 18approvedNo
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 18approvedNo
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v41 / 19approvedNo
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v41 / 19approvedNo
671amnondominant age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 19approvedNo
671amnondominant age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 20approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v41 / 21approvedNo
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 21approvedNo
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v41 / 23approvedNo
770amnondominant age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 25approvedNo
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 30approvedNo
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v41 / 33approvedNo
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 38approvedNo
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v41 / 41approvedNo
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 43approvedNo
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in mouth mucosa oral cavity indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 49approvedNo
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 52approvedNo
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 59approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 64approvedNo
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 66approvedNo
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 68approvedNo
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 79approvedNo
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 81approvedNo
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in puerto rico cayo santiago macaca mulatta indian rhesus macaque oral cavity mouth mucosa 2021-04-19v41 / 84approvedNo
770amnon high in penis male organism compared to vagina female organism in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 95approvedNo
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 110approvedNo
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 111approvedNo
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 117approvedNo
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 138approvedNo
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 140approvedNo
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 169approvedNo
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 170approvedNo
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 182approvedNo
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v41 / 208approvedNo
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 217approvedNo
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 232approvedNo
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 252approvedNo
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 280approvedNo
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 304approvedNo
1006amnoncommon rhesus macaque, macaca mulatta, bethesda, research facility, state of maryland, united states of america, captive, monkey, feces2023-01-09v41 / 318approvedNo
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v41 / 337approvedNo
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 355approvedNo
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 356approvedNo
876amnoncommon feces, age 20 months, juvenile organism, state of washington, united states of america, research facility, monkey, macaca mulatta2022-03-06v41 / 364approvedNo
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 396approvedNo
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v41 / 404approvedNo
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v11 / 423approvedNo
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 534approvedNo
671amnon high in 3-month-old human stage compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 714approvedNo
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 947approvedNo
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 955approvedNo
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 1065approvedNo

Problems / suggestions? Please email info AT dbbact DOT org