Summary for ontology term: madagascar

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.222222
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.222222
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.222222
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCAGGAAAGTCTGGAGTAAAAGGCTATGGCTCAACCATAGTGTGCTCTGGAAACTGTCTGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.222222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.222222
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.222222
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.222222

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGCGGTTTCTTAAGCGCGGGGTGAAAGGCAGTGGCTTAACCACTGTTAGCCCTGCGAACTGGGAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGCGGTCTTGAGTGAGCGAGAAGTAGGCGGAATGCGTGGT0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTCTAAGATAAAAGCCCGAGGCTTAACCTCGGTTCGTCTTAGAAACTGGTAGACTTGAGTGCAGTAGAGGCAAGTGGAATTTCTAGT0.333333
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.333333
d__BacteriaAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.370370
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTCTTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAGGGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCCAACTAAGTCTGATGTGAAATACCCGCTTTTAAGGTGGGTCGTGCATTGGAAACTGGATGGCTAGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.266667
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTCCGTAGGCGGGCTAATAAGTCAGTGGTGAAATCTCACAGCTCAACTGTGAAATTGCCATTGATACTGTTAGTCTTGAGTGAGTTTGATGTTGCTGGAATGTGTAG0.266667
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.250000
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCCGGGAATTGCGTTCTGAACTGGGTGGCTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTGATCAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGATCGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACCATAGGCTCAACCTATGGATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.222222
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__"Brachyspiraceae";g__BrachyspiraTACGTAGGAGGCAAACGTTGCTCGGATTTACTGGGCGTAAAGGGTGAGTAGGCGGATTTATAAGTCTAAGGTGAAAGACCGAAGCTCAACTTCGGGAACGCCTCGGATACTGTAAGTCTTGGATATTGTAGGGGATGATGGAATTCTCGG0.210526

Annotations:

common ontology terms
term enrichment score
TermScore
madagascar0.727273
antananarivo0.545455
central african republic0.500000
age 2-5 years0.285714
bangui0.285714
LOWER IN antananarivo0.285714
LOWER IN bangui0.285714
LOWER IN madagascar0.250000
LOWER IN central african republic0.250000
stunted growth0.166667
duodenum0.148148
iga positive fraction0.133333
LOWER IN iga negative fraction0.133333
iga negative fraction0.133333
LOWER IN iga positive fraction0.133333
child0.105263
africa0.100000
homo sapiens0.014652
feces0.012605
Fraction of dbbact annotations with this term covered by the query
TermScore
central african republic0.666667
madagascar0.666667
age 2-5 years0.500000
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
stunted growth0.500000
LOWER IN madagascar0.333333
LOWER IN central african republic0.333333
iga positive fraction0.200000
LOWER IN iga negative fraction0.200000
iga negative fraction0.200000
LOWER IN iga positive fraction0.200000
duodenum0.090909
child0.055556
africa0.052632
homo sapiens0.007380
feces0.006369
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child1.000000
africa1.000000
madagascar0.800000
feces0.600000
antananarivo0.600000
central african republic0.400000
duodenum0.400000
age 2-5 years0.200000
bangui0.200000
LOWER IN madagascar0.200000
LOWER IN antananarivo0.200000
LOWER IN central african republic0.200000
LOWER IN bangui0.200000
iga positive fraction0.100000
LOWER IN iga negative fraction0.100000
iga negative fraction0.100000
LOWER IN iga positive fraction0.100000
stunted growth0.100000

Problems / suggestions? Please email info AT dbbact DOT org