Summary for ontology term: marine sediment

Number of annotations with term: 109

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp23;g__Gp23TACGGAGGGGGCAAGCGTTATTCGGATTTACTGGGCGTAAAGCGCACGTAGGTGGCATGGTAAGTCAAAGGTGAAAGCCCTCGGCTCAACCGAGGAATTGCCTTTGAAACTGCTTTGCTTGAGTCCGGGAGGGGGGAGCGGAATTCCCAG0.038095
d__BacteriaAACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGCTTAGTAGGTTGGACGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACCGCTAGGCTCGAGGGCGGAAGAGGGGAGTGGAATTCCCGG0.038095
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGGGGGTGCAAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTCTCTAAAGTCAGATGTGAAAGCCCGGGGCTTAACCCCGGAAGTGCATTTGAAACTCAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.038095
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGAGGGTGCAAGCGTTATTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGTTTCTAAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTTGAAACTTAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.038095
d__Bacteria;p__"Chloroflexi";c__Anaerolineae;o__Anaerolineales;f__AnaerolineaceaeCACGTAGGAGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTGGTAAGTTGGATGTGAAAGCTCCTGGCTTAACTGGGAGAGGTCGTTCAATACTGCCAAACTAGAGGACGGTAGAGGAAGGTAGAATTCCTGG0.038095
d__BacteriaTACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGTGTAGGCGGTTAGGCAAGTCAGGTGTGAAATCCCTTGGCTCAACCAAGGAAGTGCGCTTGAAACTGCTTAACTAGAGTACAGGAGGGGAAAGTGGAATTCCCAG0.038095
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__ChromatialesTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGGCAGGCTAGAGTATGGTAGAGGGAAGTGGAATTCCGGG0.038095
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfuromonadales;f__DesulfuromonadaceaeTACGGAGGGTGCAAACGTTGTTCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTCTGTCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTGGAAACTGGCAGACTTGAGTACGGGAGAGGAAAGTGGAATTTCGAG0.038095
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp21;g__Gp21TACGGGGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTTTCGGAAGTCATGGGTGAAAGTCCTCGGCTCAACCGAGGGATTGCCTGTGAAACCACGGGACTGGAGTGCTGGAGAGGGAAGTGGAATTCCCAG0.038095
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGATAGAGGGGGGTAGAATTCCTGG0.038095

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTCTTTTAAGTTAGGCGTGAAAGCCCCGGGCTCAACCCGGGAACTGCGCTTAAGACTGGAAGACTAGAAAACGGAAGAGGGTAGTGGAATTCCCAG0.666667
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.500000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGCCAGTAGAATTTCCAG0.500000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGTTAGTAGAATTTCCAG0.500000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTATTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGATTCACTAGAGTACGATAGAGGGAGGTAGAATTCACAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGCTCGTAGGTGGTTAAAAAAGTTGATGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCATCAAAACTTTTTAGCTAGAGTGTGATAGAGGTAAGTGGAATTTCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTAAGTGGAATTCCGAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__DeltaproteobacteriaTACGGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGTTCGGTAAGTCAGATGTGAAAGCCCTGGGCTCAACCCAGGAAGTGCATTTGAAACTACCAGACTTGAGTACGGGAGAGGAGGGGGGAATTCCCGG0.451613
d__Bacteria;p__"Chloroflexi"CACGTAGGATCCGAGCGTTATCCGAATTTACTGGGCGTAAAGCGCGTGTAGGCGGCCGGGTAAGTTGGACGTGAAAGCTCCTGGCTCAACTAGGAGAGGTCGTTCAAAACTGCCTGGCTAGAGGGCGACAGAGGGAGGTGGAATTCCCGG0.433566
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGAGGGTGCAAGCGTTATTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGTTTCTAAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTTGAAACTTAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.423841
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGATAGAGGGGGGTAGAATTCCTGG0.418301
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGGTTGGTAAGTCAGATGTGAAAGCCCCGGGCTCAACCCGGGAAGTGCATTTGAAACTGCCTTTCTTGAGTATGGGAGAGGAGAGTGGAATTCCCAG0.417266
d__BacteriaTACGGAGGGCGCGAGCGTTATTCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCTGGGCAAGTCGGATGTGAAAGCCCGGGGCTCAACCCCGGAATTGCATTCGAAACTGCTCAGCTAGAGTCTCGGAGAGGAGGGCGGAATTCCCGG0.411765
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGAAAATTAAGTCAGTAGTGAAATCCTGCAGCTTAACTGTAGAACTGTTATTGATACTGGTTTTCTTGAATATAGTTGAGGTAGGCGGAATGTGTAA0.394904
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobulbaceaeTACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTGATAAGTCAGATGTGAAAGTCCACGGCTCAACCGTGGAAGTGCATTTGAAACTGTCAGGCTTGAGTATCGGAGGGGAGTGTGGAATTCCCGG0.391608
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGTTTGCGGCTCAACCGTAAAAGTGCCATTGATACTGGTAGTCTTGAGTACAGTAGAGGTAGGCGGAATTTATGG0.388889
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfuromonadales;f__DesulfuromonadaceaeTACGGAGGGTGCAAACGTTGTTCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTCTGTCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTGGAAACTGGCAGACTTGAGTACGGGAGAGGAAAGTGGAATTTCGAG0.386667

Annotations:

common ontology terms
term enrichment score
TermScore
marine sediment0.947608
sediment0.414846
ocean0.333618
oil seep0.251429
mangrove swamp0.244131
pacific ocean0.206061
kandelia candel0.155039
mangrove0.152866
east china sea0.141732
depth (water) 4000m0.132231
depth (water) 1000-2000m0.128000
north east pacific ocean0.125356
depth (water) 2000-3000m0.113821
estuary0.113475
spartina alterniflora0.113475
hainan autonomous prefecture0.113475
depth (water) 2000-5000m0.107692
sediment surface0.107692
hydrothermal vent0.099174
greece0.099174
marine hydrothermal vent0.099174
volcanic rock0.099174
volcanic crater0.099174
brackish water0.099174
caspian sea0.099174
futian national nature reserve0.099174
mudflat0.099174
new york city0.096970
sea water0.094737
guangdong province0.088398
zhejiang province0.087336
mediterranean sea0.082759
LOWER IN marine sediment0.079365
depth (water) 150-500m0.077519
state of new york0.075117
depth (water) 500-1000m0.069444
sediment depth 12-35cm0.068376
continental shelf0.068376
depth 400-800m0.068376
bodega bay0.068376
nan'ao island0.068376
danzhou xinyinggang nature reserve0.068376
leizhou nature reserve0.068376
ximendao national marine reserve0.068376
dongzhaigang national nature reserve0.068376
shenzhen futian national nature reserve0.068376
LOWER IN other regions0.068376
zostera marina0.066116
marine eelgrass0.066116
depth (water) 200m0.064000
san diego0.064000
water0.062581
antarctica0.060150
LOWER IN sediment0.055944
active vent0.052174
inactive vent0.052174
polymetallic nodule0.052174
hunts point0.052174
soundview0.052174
oyster reef0.052174
other regions0.052174
depth (soil) 0-20cm0.044255
LOWER IN sea water0.041379
state of california0.036866
klamath knoll0.035398
astorya canyon sw wall0.035398
juan de fuca nehalem0.035398
hecceta sw0.035398
coquille sw0.035398
barkley canyon0.035398
cascadia basin0.035398
sediment depth 0-12cm0.035398
depth (water) 150-600m0.035398
clayoquot slope0.035398
endeavour0.035398
rhizophora stylosa0.035398
shore0.035398
depth (water) 150m0.034188
LOWER IN depth (water) 1000-2000m0.034188
depth (water) 1000m0.034188
sediment depth 0-5cm0.034188
hawaii0.033613
caribbean sea0.033058
colombia0.032520
china0.031026
atlantic ocean0.025157
LOWER IN water0.024390
soil0.019013
LOWER IN active vent0.018018
LOWER IN inactive vent0.018018
LOWER IN depth 8-10cm0.018018
LOWER IN polymetallic nodule0.018018
LOWER IN sediment depth 12-24cm0.018018
sediment depth 24-35cm0.018018
sediment depth 12-24cm0.018018
LOWER IN sediment depth 24-35cm0.018018
LOWER IN soundview0.018018
LOWER IN oyster reef0.018018
LOWER IN hunts point0.018018
hangzhou bay0.018018
Fraction of dbbact annotations with this term covered by the query
TermScore
marine sediment0.941176
depth (water) 4000m0.666667
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
inactive vent0.500000
LOWER IN active vent0.500000
LOWER IN inactive vent0.500000
klamath knoll0.500000
astorya canyon sw wall0.500000
juan de fuca nehalem0.500000
depth (water) 1000-2000m0.500000
hecceta sw0.500000
coquille sw0.500000
barkley canyon0.500000
depth (water) 2000-3000m0.500000
cascadia basin0.500000
LOWER IN depth 8-10cm0.500000
polymetallic nodule0.500000
LOWER IN polymetallic nodule0.500000
sediment depth 0-12cm0.500000
brackish water0.500000
caspian sea0.500000
depth (water) 150-600m0.500000
sediment depth 12-35cm0.500000
LOWER IN sediment depth 12-24cm0.500000
sediment depth 24-35cm0.500000
sediment depth 12-24cm0.500000
LOWER IN sediment depth 24-35cm0.500000
continental shelf0.500000
depth 400-800m0.500000
bodega bay0.500000
nan'ao island0.500000
clayoquot slope0.500000
hunts point0.500000
LOWER IN soundview0.500000
LOWER IN oyster reef0.500000
soundview0.500000
oyster reef0.500000
LOWER IN hunts point0.500000
endeavour0.500000
danzhou xinyinggang nature reserve0.500000
rhizophora stylosa0.500000
leizhou nature reserve0.500000
kandelia candel0.500000
ximendao national marine reserve0.500000
futian national nature reserve0.500000
mudflat0.500000
dongzhaigang national nature reserve0.500000
shenzhen futian national nature reserve0.500000
east china sea0.500000
hangzhou bay0.500000
LOWER IN other regions0.500000
shore0.500000
LOWER IN hangzhou bay0.500000
other regions0.500000
sanmen bay0.500000
LOWER IN sanmen bay0.500000
yushan islands0.500000
LOWER IN yushan islands0.500000
zhoushan island0.500000
oil seep0.333333
sediment depth 8-10cm0.333333
depth (water) 2000-5000m0.333333
depth 0-5cm0.333333
zostera marina0.333333
marine eelgrass0.333333
sediment surface0.333333
LOWER IN sediment surface0.333333
sediment0.323529
ocean0.312500
LOWER IN marine sediment0.294118
depth (water) 150-500m0.250000
depth (water) 150m0.250000
LOWER IN sediment depth 0-5cm0.250000
LOWER IN depth (water) 1000-2000m0.250000
depth (water) 200m0.250000
estuary0.250000
mangrove swamp0.250000
spartina alterniflora0.250000
hainan autonomous prefecture0.250000
mangrove0.250000
LOWER IN depth (water) 2000-3000m0.250000
depth (water) 1000m0.250000
sediment depth 0-5cm0.250000
san diego0.250000
hawaii0.200000
mediterranean sea0.166667
antarctica0.166667
LOWER IN depth (water) 2000-5000m0.166667
caribbean sea0.166667
pacific ocean0.153846
depth (water) 500-1000m0.142857
LOWER IN depth (water) 500-1000m0.142857
new york city0.142857
colombia0.142857
LOWER IN sediment0.117647
Fraction of annotations for the query sequences containing the term
TermScore
marine sediment0.954128
sediment0.577982
ocean0.357798
china0.357798
pacific ocean0.311927
depth (soil) 0-20cm0.238532
soil0.238532
mangrove swamp0.238532
north east pacific ocean0.201835
oil seep0.201835
mangrove0.110092
kandelia candel0.091743
zhejiang province0.091743
sea water0.082569
east china sea0.082569
water0.073394
depth (water) 1000-2000m0.073394
depth (water) 4000m0.073394
estuary0.073394
united states of america0.073394
state of new york0.073394
new york city0.073394
spartina alterniflora0.073394
hainan autonomous prefecture0.073394
guangdong province0.073394
depth (water) 2000-5000m0.064220
depth (water) 2000-3000m0.064220
sediment surface0.064220
hydrothermal vent0.055046
greece0.055046
mediterranean sea0.055046
marine hydrothermal vent0.055046
volcanic rock0.055046
volcanic crater0.055046
brackish water0.055046
caspian sea0.055046
futian national nature reserve0.055046
mudflat0.055046
depth (water) 150-500m0.045872
depth (water) 500-1000m0.045872
LOWER IN marine sediment0.045872
sediment depth 12-35cm0.036697
depth (water) 200m0.036697
antarctica0.036697
continental shelf0.036697
depth 400-800m0.036697
state of california0.036697
bodega bay0.036697
zostera marina0.036697
marine eelgrass0.036697
LOWER IN sediment0.036697
nan'ao island0.036697
danzhou xinyinggang nature reserve0.036697
leizhou nature reserve0.036697
ximendao national marine reserve0.036697
dongzhaigang national nature reserve0.036697
shenzhen futian national nature reserve0.036697
san diego0.036697
LOWER IN other regions0.036697
active vent0.027523
inactive vent0.027523
polymetallic nodule0.027523
LOWER IN sea water0.027523
hunts point0.027523
soundview0.027523
oyster reef0.027523
other regions0.027523
klamath knoll0.018349
astorya canyon sw wall0.018349
depth (water) 150m0.018349
juan de fuca nehalem0.018349
hecceta sw0.018349
coquille sw0.018349
barkley canyon0.018349
cascadia basin0.018349
LOWER IN depth (water) 1000-2000m0.018349
sediment depth 0-12cm0.018349
depth (water) 150-600m0.018349
LOWER IN water0.018349
clayoquot slope0.018349
endeavour0.018349
rhizophora stylosa0.018349
atlantic ocean0.018349
depth (water) 1000m0.018349
sediment depth 0-5cm0.018349
hawaii0.018349
shore0.018349
colombia0.018349
caribbean sea0.018349
LOWER IN active vent0.009174
LOWER IN inactive vent0.009174
sediment depth 8-10cm0.009174
LOWER IN sediment depth 0-5cm0.009174
depth 0-5cm0.009174
LOWER IN depth 8-10cm0.009174
LOWER IN depth (water) 500-1000m0.009174
LOWER IN polymetallic nodule0.009174
LOWER IN sediment depth 12-24cm0.009174
sediment depth 24-35cm0.009174
sediment depth 12-24cm0.009174
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
223amnon high in other regions compared to sanmen bay in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 3
472amnondominant depth (water) 500-1000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon2019-01-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 4
472amnondominant depth (water) 1000-2000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw2019-01-16v4No1 / 5
141amnondominant sediment depth 0-12cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 150-600m2017-04-18v4No1 / 5
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 5
472amnondominant depth (water) 1000-2000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope2019-01-16v4No1 / 5
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 5
235amnonhigh freq. in sediment near eelgrass in northern hemisphere (dominant sediment, marine sediment, ocean)2017-11-07v4No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
642amnondominant marine sediment, sediment, san diego, pacific ocean2020-08-28v4No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 7
472amnondominant depth (water) 2000-5000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour2019-01-16v4No1 / 7
545amnondominant sediment, sediment depth 0-5cm, depth (water) 1000m, ocean, atlantic ocean, marine sediment2019-08-04v4No1 / 7
93amnonhigh freq. in marine sediment near the shore in hawaii (dominant hawaii, shore, marine sediment)2017-03-12v4No1 / 7
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 8
472amnondominant depth (water) 2000-5000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin2019-01-16v4No1 / 8
722amnondominant estuary, marine sediment, sediment, united states of america, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 8
722amnondominant estuary, marine sediment, sediment, united states of america, state of new york, new york city, sediment surface, oyster reef, soundview2021-01-02v4No1 / 8
223amnondominant sediment, marine sediment, ocean, east china sea, china2017-10-26v4No1 / 8
472amnondominant depth (water) 500-1000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw2019-01-16v4No1 / 10
142amnonhigh freq. in cruise 1 (western antarctica) (dominant marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 10
142amnonhigh freq. in cruise 2 (western antarctica) (dominant marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 10
141amnondominant sediment depth 12-35cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 200m2017-04-18v4No1 / 11
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 12
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 12
139amnondominant pacific ocean, depth (water) 4000m, marine sediment, polymetallic nodule2017-04-18v4No1 / 12
504amnondominant nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 12
472amnondominant ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, klamath knoll, depth (water) 150-500m2019-01-16v4No1 / 13
138amnondominant pacific ocean, depth (water) 4000m, marine sediment2017-04-18v4No1 / 13
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 18
772amnondominant in sediment from southern colombian caribbean sea (dominant depth (water) 2000-5000m, depth (water) 1000-2000m, sediment, colombia, caribbean sea, depth (water) 2000-3000m, marine sediment)2021-04-22v3No1 / 18
223amnon high in other regions compared to hangzhou bay in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 21
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
141amnonpositively correlated with sample depth ( high in sediment depth 24-35cm compared to sediment depth 12-24cm in sediment depth 12-35cm marine sediment brackish water sediment caspian sea depth (water) 200m )2017-04-18v4No1 / 56
642amnon high in water saline water sea water compared to marine sediment sediment in san diego pacific ocean 2020-08-28v4No1 / 56
223amnon high in zhoushan island compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 67
223amnon high in hangzhou bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 90
772amnoncommon in sediment from southern colombian caribbean sea (common depth (water) 2000-5000m, depth (water) 1000-2000m, sediment, colombia, caribbean sea, depth (water) 2000-3000m, marine sediment)2021-04-22v3No1 / 94
223amnon high in sanmen bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 110
362amnon high in inactive vent compared to active vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 129
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
141amnonnegatively correlated with sample depth ( high in sediment depth 12-24cm compared to sediment depth 24-35cm in sediment depth 12-35cm marine sediment brackish water sediment caspian sea depth (water) 200m )2017-04-18v4No1 / 187
235amnoncommon in sediment near eelgrass in northern hemisphere (common sediment, marine sediment, ocean)2017-11-07v4No1 / 258
223amnon high in other regions compared to yushan islands in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 302
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
722amnon high in surface water sea water compared to sediment surface marine sediment sediment in estuary new york city state of new york united states of america 2021-01-02v4No1 / 399
642amnoncommon marine sediment, sediment, san diego, pacific ocean2020-08-28v4No1 / 404
545amnoncommon atlantic ocean, ocean, depth (water) 1000m, sediment depth 0-5cm, sediment, marine sediment2019-08-04v4No1 / 436
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
142amnoncommon in cruise 2 (western antarctica) (common marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 468
722amnon high in soundview oyster reef compared to hunts point in estuary marine sediment sediment united states of america state of new york new york city sediment surface 2021-01-02v4No1 / 469
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 480
139amnonpositively correlated with sediment depth (in ocean floor depth 4000m) ( high in sediment depth 8-10cm compared to sediment depth 0-5cm in pacific ocean depth (water) 4000m marine sediment )2017-04-18v4No1 / 522
472amnoncommon ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 535
472amnoncommon depth (water) 500-1000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw2019-01-16v4No1 / 554
139amnonnegatively correlated with sediment depth (in ocean floor depth 4000m) ( high in depth 0-5cm compared to depth 8-10cm in pacific ocean depth (water) 4000m marine sediment )2017-04-18v4No1 / 565
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
722amnon high in hunts point compared to soundview oyster reef in estuary marine sediment sediment united states of america state of new york new york city sediment surface 2021-01-02v4No1 / 696
472amnoncommon depth (water) 1000-2000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope2019-01-16v4No1 / 725
142amnoncommon in cruise 1 (western antarctica) (common marine sediment, sediment, antarctica, continental shelf, depth 400-800m)2017-04-19v4No1 / 756
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 758
472amnoncommon ocean, sediment, marine sediment, pacific ocean, north east pacific ocean, oil seep, klamath knoll, depth (water) 150-500m2019-01-16v4No1 / 789
472amnoncommon depth (water) 2000-5000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin2019-01-16v4No1 / 878
722amnoncommon estuary, marine sediment, sediment, united states of america, state of new york, new york city, sediment surface, oyster reef, soundview2021-01-02v4No1 / 922
472amnoncommon depth (water) 500-1000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon2019-01-16v4No1 / 990
722amnoncommon estuary, marine sediment, sediment, united states of america, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 1001
93amnoncommon in marine sediment near the shore in hawaii (common hawaii, shore, marine sediment)2017-03-12v4No1 / 1151
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
139amnoncommon pacific ocean, depth (water) 4000m, marine sediment, polymetallic nodule2017-04-18v4No1 / 1196
472amnoncommon depth (water) 2000-5000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour2019-01-16v4No1 / 1205
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
472amnoncommon depth (water) 1000-2000m, ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw2019-01-16v4No1 / 1275
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
139amnon high in polymetallic nodule compared to marine sediment in pacific ocean depth (water) 4000m 2017-04-18v4No1 / 1483
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
141amnoncommon sediment depth 0-12cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 150-600m2017-04-18v4No1 / 1549
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
141amnoncommon sediment depth 12-35cm, marine sediment, brackish water, sediment, caspian sea, depth (water) 200m2017-04-18v4No1 / 1659
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
722amnon high in sediment marine sediment sediment surface compared to sea water surface water in estuary united states of america state of new york new york city 2021-01-02v4No1 / 1736
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
138amnoncommon pacific ocean, depth (water) 4000m, marine sediment2017-04-18v4No1 / 1753
472amnon high in depth (water) 500-1000m depth (water) 150-500m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1899
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
472amnon high in depth (water) 2000-5000m depth (water) 2000-3000m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1923
472amnon high in depth (water) 1000-2000m compared to depth (water) 2000-5000m depth (water) 2000-3000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
139amnon high in marine sediment compared to polymetallic nodule in pacific ocean depth (water) 4000m 2017-04-18v4No1 / 2686
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
472amnon high in depth (water) 1000-2000m compared to depth (water) 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000
642amnon high in marine sediment sediment compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 3217

Problems / suggestions? Please email info AT dbbact DOT org