Summary for ontology term: material property

Number of annotations with term: 1108

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.031313
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.027273
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.025253
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACTGGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTAGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.023232
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.022222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.021212
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.021212
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.021212
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.020202

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.109859
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.076056
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.070423
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.050704
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.050704
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.045070
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.042254
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.042254
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.039437
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.036620

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.181127
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.151475
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.151237
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.144385
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.144345
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.143345
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.143262
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.142549
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.132968
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.132926

Annotations:

common ontology terms
term enrichment score
TermScore
homo sapiens0.542789
feces0.478337
control0.470363
adult0.431572
female0.379009
LOWER IN control0.347082
research facility0.335434
united states of america0.310278
male0.237595
china0.236981
mus musculus0.236015
mouse0.221427
child0.100903
caecum0.096154
c57bl/60.089110
subgingival plaque0.078584
canada0.075710
kingdom of spain0.071768
saliva0.070080
pregnancy0.067811
human adult stage0.061872
periodontitis0.059397
obesity0.057110
rat0.054608
antibiotic0.054139
state of california0.053156
vagina0.051591
mouth0.050719
skin0.050010
australia0.047313
chicken0.046980
germany0.046921
gallus gallus0.046797
soil0.044718
hiv infection0.044023
LOWER IN antibiotic0.043937
c57bl/6j0.043581
dentition0.042666
sprague dawley0.042179
subgingival dental plaque0.041958
adult organism0.040310
kingdom of the netherlands0.040182
pig0.039867
sus scrofa0.039867
whole body0.039274
LOWER IN female0.039082
guangzhou city prefecture0.038749
rattus norvegicus0.037620
sweden0.037378
body proper0.036789
LOWER IN male0.036389
south korea0.035996
age 25-45 years0.035149
nasopharynx0.035047
municipality of beijing0.034843
oral cavity0.034757
amsterdam0.033576
msm0.033436
homosexual0.033436
male organism0.033159
japan0.032407
diet0.031731
czech republic0.031469
horse0.031102
equus caballus0.031102
panama0.030050
ulcerative colitis0.030021
tongue0.029951
zhejiang province0.029596
age 6 weeks0.029336
dog0.029031
canis lupus familiaris0.028852
crohn's disease0.028402
province of alberta0.028269
coyote0.028070
canis latrans0.028070
edmonton0.028070
israel0.027902
mouth mucosa0.027875
high bmi0.027759
pathogen0.026684
rumen0.026667
united kingdom0.026578
balb/c0.026502
hospital0.026362
high fat diet0.026362
italy0.025199
belgium0.024447
age 2 months0.023127
LOWER IN periodontitis0.023075
obsolete_juvenile stage0.022797
ph 7-80.022562
farm0.021882
infant0.021568
colon0.021529
LOWER IN crohn's disease0.021366
ascending colon0.021314
parkinson's disease0.021277
difenoconazole0.021201
fungicide0.021201
Fraction of dbbact annotations with this term covered by the query
TermScore
third trimester1.000000
dental caries1.000000
LOWER IN dental caries1.000000
non-pregnant1.000000
LOWER IN non-pregnant1.000000
antimicrobial agent1.000000
antibiotics supllemented diet1.000000
LOWER IN antibiotics supllemented diet1.000000
female0.984848
control0.952632
LOWER IN control0.936842
pregnancy0.923077
periodontitis0.923077
pathogen0.923077
hiv infection0.900000
male0.886364
crohn's disease0.857143
LOWER IN metronidazole0.857143
antibiotic0.833333
LOWER IN antibiotic0.833333
LOWER IN hiv infection0.800000
amsterdam0.800000
sprague dawley0.800000
LOWER IN vancomycin0.800000
clostridium difficile infection0.800000
age 2 months0.800000
guangzhou city prefecture0.800000
LOWER IN crohn's disease0.785714
taiwan0.750000
stress0.750000
LOWER IN stress0.750000
LOWER IN type i diabetes mellitus0.750000
type i diabetes mellitus0.750000
systemic lupus erythematosus0.750000
LOWER IN systemic lupus erythematosus0.750000
clostridium difficile colitis0.750000
probiotics0.750000
subgingival plaque0.733333
metronidazole0.714286
obesity0.692308
LOWER IN periodontitis0.692308
ulcerative colitis0.692308
diarrhea0.666667
vaccination0.666667
autistic disorder0.666667
LOWER IN autistic disorder0.666667
msm0.666667
homosexual0.666667
helicobacter pylori infectious disease0.666667
LOWER IN pancreatic cancer0.666667
first trimester0.666667
depth0.666667
restricted feed0.666667
sulfide0.666667
LOWER IN drought environment0.666667
drought environment0.666667
ovariectomy0.666667
atlanta0.666667
tracheal aspirate0.666667
shanghai district0.666667
before antibiotics0.666667
subgingival dental plaque0.666667
mussel0.666667
ascending colon0.666667
province of alberta0.666667
LOWER IN ascending colon0.666667
hymenolepis diminuta0.666667
LOWER IN hymenolepis diminuta0.666667
probiotic0.666667
mouth neoplasm0.666667
LOWER IN mouth neoplasm0.666667
nanchang city prefecture0.666667
10-15-years-old human0.666667
LOWER IN remission0.666667
remission0.666667
overweight body mass index status0.666667
age 25-45 years0.666667
chronic periodontitis0.666667
clostridium difficile0.666667
republic of china0.666667
salmonella gastroenteritis0.666667
larvae0.666667
metabolic syndrome0.666667
LOWER IN western diet0.666667
western diet0.666667
c57bl/60.650000
c57bl/6j0.636364
tongue0.625000
balb/c0.625000
kingdom of the netherlands0.625000
LOWER IN ulcerative colitis0.615385
nasopharynx0.600000
parkinson's disease0.600000
LOWER IN parkinson's disease0.600000
depth 5cm0.600000
LOWER IN parasitic helminthiasis infectious disease0.600000
parasitic helminthiasis infectious disease0.600000
vancomycin0.600000
LOWER IN ampicillin0.600000
ampicillin0.600000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.556859
feces0.531588
adult0.373646
control0.312274
united states of america0.294224
research facility0.267148
female0.234657
LOWER IN control0.212996
china0.199458
mus musculus0.148014
male0.137184
mouse0.137184
child0.055957
caecum0.054152
c57bl/60.047834
canada0.043321
subgingival plaque0.041516
saliva0.039711
kingdom of spain0.038809
human adult stage0.036101
pregnancy0.035199
periodontitis0.030686
obesity0.029783
state of california0.028881
soil0.028881
rat0.028881
germany0.028881
antibiotic0.027978
skin0.027978
vagina0.027076
mouth0.027076
australia0.025271
chicken0.025271
gallus gallus0.025271
adult organism0.023466
hiv infection0.022563
LOWER IN antibiotic0.022563
dentition0.022563
c57bl/6j0.022563
sprague dawley0.021661
subgingival dental plaque0.021661
pig0.021661
sus scrofa0.021661
LOWER IN female0.020758
sweden0.020758
whole body0.020758
kingdom of the netherlands0.020758
rattus norvegicus0.019856
body proper0.019856
guangzhou city prefecture0.019856
LOWER IN male0.018953
south korea0.018953
nasopharynx0.018051
oral cavity0.018051
municipality of beijing0.018051
age 25-45 years0.018051
japan0.017148
msm0.017148
homosexual0.017148
amsterdam0.017148
diet0.017148
male organism0.017148
czech republic0.016245
horse0.016245
equus caballus0.016245
panama0.016245
tongue0.015343
zhejiang province0.015343
dog0.015343
canis lupus familiaris0.015343
ulcerative colitis0.015343
age 6 weeks0.015343
crohn's disease0.014440
mouth mucosa0.014440
israel0.014440
rumen0.014440
united kingdom0.014440
high bmi0.014440
province of alberta0.014440
wild0.014440
coyote0.014440
canis latrans0.014440
edmonton0.014440
balb/c0.013538
pathogen0.013538
italy0.013538
hospital0.013538
high fat diet0.013538
belgium0.012635
ph 7-80.012635
colon0.011733
LOWER IN periodontitis0.011733
rhizosphere0.011733
obsolete_juvenile stage0.011733
infant0.011733
farm0.011733
age 2 months0.011733
LOWER IN crohn's disease0.010830
captive0.010830
parkinson's disease0.010830
Exp. ID User ID Description Date Region Flag Sequences
37amnonhigh in tomato plant leaves compared to plastic control ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v4No1 / 1
59amnoncandidate pathogen (Melissococcus plutonius). Causes European Foulbrood of honeybees (other pathogen, apis mellifera)2017-02-02v4No1 / 1
569amnonHelicobacter pylori pathogen (other homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori, pathogen, helicobacter pylori infectious disease)2019-12-16v3No1 / 1
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 1
77amnon high in depth 0.02-0.03 depth compared to depth 0.01-0.02 in ecklonia radiata winter kelp forest algae australia 2017-02-28v4No1 / 1
607amnon high in control compared to parkinson's disease in germany nasopharynx homo sapiens nasal wash 2020-04-19v4No1 / 1
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system sea water china )2017-03-06v4No1 / 1
98amnonHuanglongbing (Citrus greening) disease (other citrus, pathogen, leaf, huanglongbing, disease, state of florida)2017-04-01v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in bisphenol a estradiol compared to control in danio rerio zebra fish intestine research facility china )2017-04-09v4No1 / 1
114amnon high in control compared to polychlorinated biphenyl 126 pcb contaminated water in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in high neutrophils neutrophil hirschsprung disease compared to low neutrophils control in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to hirschsprung disease high neutrophils neutrophil in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
121amnoncausitive agent for acute diarrhea (other pathogen, homo sapiens, feces, bangladesh, diarrhea)2017-04-13v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v4No1 / 1
144amnon high in ancylostoma compared to control in canis lupus familiaris dog australia feces 2017-04-19v4No1 / 1
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in nasal cavity bos taurus calve united states of america juvenile organism pair of nares )2017-07-04v4No1 / 1
664amnoncausitive bacteria for ehrlichiosis (other blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog, ehrlichiosis, ehrlichia canis, pathogen)2020-09-22v4No1 / 1
664amnondog blood mycoplasma (other mycoplasma haemocanis, blood, pathogen, semi domestic dog, bangkok, thailand, canis lupus familiaris, dog)2020-09-22v4No1 / 1
664amnonanaplasmosis causing pathogen (other anaplasma platys, anaplasmosis, pathogen, blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog)2020-09-22v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 1
188amnonSalmonella enterica (other pathogen)2017-08-24v4No1 / 1
189amnoncauses Pierce’s Disease in grapes (other pathogen)2017-08-30v4No1 / 1
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v3No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 1
207amnonPathogen - campylobacter (human diarrhea) (other pathogen)2017-10-05v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
702amnon high in control compared to clostridium difficile infection in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v4No1 / 1
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 1
728amnonclostridium difficile pathogen (other pathogen, clostridium difficile)2021-01-05v3No1 / 1
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 1
325amnonclostridium difficile pathogen (other pathogen, clostridium difficile)2018-04-29v4No1 / 1
335amnonTropheryma whipplei (other homo sapiens, bronchial epithelium, pathogen, whipple disease, whipple's disease)2018-05-16v4No1 / 1
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 1
384amnon high in asthma compared to control in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 1
857amnon high in bacillus thuringiensis toxin producing cotton compared to control in cotton field bollworm helicoverpa zea third instar larva stage larvae whole body state of north carolina agricultural feature 2022-01-10v3No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v4No1 / 1
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in plant fiber cell high fiber high arabinoxylan and resistant starch diet compared to control diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 1
9amnonmuch higher when coral is present ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 2
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens russia adult 2020-01-05v3No1 / 2
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 2
604amnon high in infectious bronchitis virus bronchitis compared to control in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 2
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 2
102amnon high in hiv infection compared to control in homo sapiens atlanta united states of america cheek mouth 2017-04-04v4No1 / 2
114amnon high in polychlorinated biphenyl 126 pcb contaminated water compared to control in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v3No1 / 2
227amnonlower in infants with respiratory illness compared to healthy controls ( high in control compared to respiratory system disease in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v4No1 / 2
239amnon high in control compared to colorectal adenocarcinoma colorectal cancer carcinoma in homo sapiens feces united states of america 2017-11-08v4No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
344amnon high in control compared to hiv infection in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 2
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v3No1 / 2
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 2
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 3
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v4No1 / 3
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 3
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 3
593amnon high in osteoarthritis compared to rheumatoid arthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 3
607amnon high in parkinson's disease rem sleep behavior disorder compared to control in germany homo sapiens feces 2020-04-19v4No1 / 3
104amnon high in control compared to periodontitis in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
203amnon high in male compared to female in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth 2017-10-01v4No1 / 3
689amnon high in clostridium difficile infection clostridium difficile colitis compared to non c. diff diarrhea in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 3
231amnonhigher in female compared to male in dog genitalia ( high in female compared to male in dog canis lupus familiaris united states of america reproductive system reproductive organ genitalia )2017-11-02v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
894amnon high in diaporthe citri plant disease compared to control in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 3
902amnondominant adult organism, horse, equus caballus, united states of america, control, feces2022-05-02v4No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 3
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 4
570amnon high in visceral leishmaniasis compared to control in homo sapiens feces india bihar state 2019-12-16v3No1 / 4
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 4
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in germany homo sapiens feces 2020-04-19v4No1 / 4
102amnon high in hiv infection compared to control in homo sapiens atlanta united states of america dentition mouth 2017-04-04v4No1 / 4
685amnon high in control compared to helicobacter pylori infectious disease in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 4
203amnon high in female compared to male in homo sapiens oral cavity obsolete_juvenile stage dentition australia mouth 2017-10-01v4No1 / 4
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v4No1 / 4
716amnon high in chronic bad breath halitosis compared to control in tongue china dermal layer of tongue homo sapiens adult 2028-05-22v3No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 4
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
528amnoncommon homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 5
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 5
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 5
598amnon high in male compared to female in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
598amnon high in female compared to male in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
607amnon high in parkinson's disease compared to control in germany nasopharynx homo sapiens nasal wash 2020-04-19v4No1 / 5
96amnon high in control compared to systemic lupus erythematosus in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 5
104amnon high in periodontitis compared to control in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 5
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to allergy atopic dermatitis in cat felis catus skin united states of america )2017-07-05v4No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 5
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in homo sapiens feces united states of america )2017-10-23v4No1 / 5
266amnonbrassicaceae fungal pathogen (other pathogen, fungal cell)2017-12-18v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 5
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 5
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in 2-month-old human stage homo sapiens infant vellore district city india )2018-05-14v4No1 / 5
794amnon high in antiretroviral therapy human immunodeficiency virus infectious disease hiv infection compared to control in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 5
831amnon high in control compared to pancreatic cancer in israel adult feces homo sapiens 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 5
894amnon high in control compared to diaporthe citri plant disease in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
448amnonhigh freq. in healthy horse feces (dominant equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 5
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 6
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens mouth mucosa oral cavity mouth china 2017-10-01v4No1 / 6
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 6
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 6
227amnonhigher in infants with respiratory illness compared to healthy controls ( high in respiratory system disease compared to control in kingdom of the netherlands infant nasopharynx nasal cavity homo sapiens )2017-10-30v4No1 / 6
239amnon high in colorectal adenocarcinoma colorectal cancer carcinoma compared to control in homo sapiens feces united states of america 2017-11-08v4No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
773amnon high in recurrent tonsillitis tonsillitis compared to iga glomerulonephritis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 6
344amnon high in hiv infection compared to control in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 6
384amnon high in control compared to asthma in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v4No1 / 6
423amnon high in female compared to male in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 6
702amnon high in clostridium difficile infection compared to control in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v4No1 / 6
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 6
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
535amnoncommon in healthy adult vaginal samples (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
102amnon high in control compared to periodontitis in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 7
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 7
685amnon high in helicobacter pylori infectious disease compared to control in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 7
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
730amnon high in crohn's disease compared to control in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
37amnonhigh in tomato plant leaves compared to plastic controls ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v4No1 / 8
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in liolaemus ruibali argentina research facility small intestine )2017-02-25v4No1 / 8
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
674amnondominant nyssomyia trapidoi, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 8
701amnondominant municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 8
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
819amnondominant dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
535amnon high in dysplasia of cervix compared to control in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 9
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 9
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, biochar)2020-04-21v4No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in amsterdam kingdom of the netherlands adult homosexual msm feces homo sapiens 2020-05-31v4No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 9
678amnon high in tooth disease black dental staining compared to control in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 9
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 9
744amnondominant ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 9
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
819amnondominant adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 9
819amnondominant skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 9
894amnon high in control compared to plant disease diaporthe citri in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 10
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v3No1 / 10
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 10
595amnon high in male compared to female in ixodes ricinus castor bean tick whole body switzerland 2020-03-16v4No1 / 10
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 10
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 10
700amnon high in caecum compared to colon in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
740amnon high in male male organism compared to female female organism in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 10
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
857amnon high in control compared to bacillus thuringiensis toxin producing cotton in cotton field bollworm helicoverpa zea third instar larva stage larvae whole body state of north carolina agricultural feature 2022-01-10v3No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v4No1 / 11
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to teeth braces braces in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 11
96amnon high in systemic lupus erythematosus compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 11
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in soil united states of america state of california depth 5cm )2017-07-25v4No1 / 11
191amnondominant homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 11
202amnon high in mouth neoplasm neoplasm cancer compared to control in homo sapiens mouth mucosa china mouth oral cavity 2017-10-01v4No1 / 11
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 11
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in omsk russia intestinal contents intestine farm peking duck anas platyrhynchos )2021-06-07v3No1 / 11
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in age 25-45 years china scalp adult skin female homo sapiens 2021-07-12v1No1 / 11
819amnondominant dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 11
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 11
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, jejunum2022-04-19v4No1 / 11
898amnon high in jejunum duodenum compared to descending colon ascending colon feces in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 12
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
773amnon high in iga glomerulonephritis compared to recurrent tonsillitis tonsillitis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 12
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 12
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 12
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
898amnoncommon duodenum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 12
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, duodenum2022-04-19v4No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
611amnon high in male compared to female in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 13
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 13
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 13
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
713amnon high in remission compared to active disease in crohn's disease feces homo sapiens 2028-05-21v3No1 / 13
232amnonhigher in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in ulcer wound compared to control in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 13
725amnondominant control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
861amnondominant urban community, soweto, rural community, south africa, city, female, homo sapiens, feces2022-01-15v3No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v4No1 / 13
902amnondominant salmonellosis, adult organism, horse, equus caballus, salmonella gastroenteritis, antibiotic, united states of america, feces2022-05-02v4No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 14
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
560amnondominant ceratotherium simum, white rhinoceros, ceratotherium simum simum, zoological garden, captive, united states of america, san diego zoo, female2019-11-04v4No1 / 14
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 14
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 14
673amnondominant control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 14
693amnondominant graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
560amnondominant zoological garden, captive, united states of america, san diego zoo, female, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 15
102amnon high in control compared to hiv infection in homo sapiens atlanta united states of america cheek mouth 2017-04-04v4No1 / 15
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
673amnoncommon salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 15
674amnondominant culicoides helicaniae, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 15
674amnondominant culex declarator, mosquito, whole body, body proper, female, panama2020-09-28v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 15
723amnoncommon municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 15
300amnondominant rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 15
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
819amnoncommon dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 15
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 15
898amnoncommon jejunum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 15
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
528amnondominant homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 16
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 16
604amnon high in control compared to infectious bronchitis virus bronchitis in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 16
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 16
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
678amnondominant control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 16
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 16
713amnon high in active disease compared to remission in crohn's disease feces homo sapiens 2028-05-21v3No1 / 16
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
794amnondominant control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
570amnon high in control compared to visceral leishmaniasis in homo sapiens feces india bihar state 2019-12-16v3No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v3No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
607amnondominant germany, homo sapiens, feces, control2020-04-19v4No1 / 17
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, control2020-04-19v4No1 / 17
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
674amnondominant mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 17
674amnondominant mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
725amnondominant periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 17
730amnondominant control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 17
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 17
897amnondominant adelaide, broiler chicken, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 17
897amnondominant isa brown, layer chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 17
898amnondominant coyote, canis latrans, edmonton, adult organism, ascending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 18
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 18
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 18
607amnondominant germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 18
84amnonincreases in drought in late time points ( high in drought environment timepoint compared to control in depth 5cm soil temperate grassland biome fen peat soil flooded grassland biome united kingdom )2017-03-07v4No1 / 18
102amnon high in control compared to hiv infection in homo sapiens atlanta united states of america dentition mouth 2017-04-04v4No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
636amnon high in tracheal aspirate endotracheal aspirate trachea compared to oropharynx oropharyngeal swab in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 18
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 18
717amnon high in male organism male compared to female organism female in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 18
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
744amnondominant cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 18
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v3No1 / 18
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v3No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, wild, canada, male, feces2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, descending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, ileum2022-04-19v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 19
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 19
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, parkinson's disease2020-04-19v4No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 19
232amnonhigher in diabetec patient foot skin compared to healthy controls ( high in diabetes mellitus compared to control in homo sapiens skin australia foot )2017-11-05v4No1 / 19
723amnondominant adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 19
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 19
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, caecum2022-04-19v4No1 / 19
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 20
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v4No1 / 20
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 20
697amnondominant sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 20
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 20
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 20
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v3No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 21
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
663amnon high in low bmi compared to obese body mass index status high bmi obesity in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 21
674amnondominant culicoides batesi, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 21
744amnondominant caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 21
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v3No1 / 21
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v4No1 / 21
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v4No1 / 21
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 21
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 21
611amnon high in ovariectomy ovariectomized female compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 22
673amnondominant caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 22
674amnondominant sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 22
674amnondominant psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 22
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 22
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
819amnoncommon adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 22
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 22
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 22
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 22
63amnon high in male compared to female in homo sapiens skin 2017-02-15v4No1 / 23
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 23
717amnon high in female organism female compared to male organism male in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 23
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 23
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 23
773amnondominant recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v3No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v4No1 / 24
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
721amnonhigher in high protein weight loss diet compared to control diet ( high in high protein diet weight loss diet weight loss compared to control diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 24
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 24
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v3No1 / 24
898amnoncommon ileum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
607amnoncommon germany, homo sapiens, nasopharynx, nasal wash, rem sleep behavior disorder2020-04-19v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 25
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 25
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 25
674amnondominant biting midge, culicoides foxi, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in omsk russia intestinal contents intestine farm peking duck anas platyrhynchos )2021-06-07v3No1 / 25
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v3No1 / 25
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 26
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in nasal cavity bos taurus calve united states of america juvenile organism pair of nares )2017-07-04v4No1 / 26
674amnoncommon mosquito, coquillettidia, coquilettidia venezuelensis, whole body, body proper, female, panama2020-09-28v4No1 / 26
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
605amnon high in control compared to recurrent otitis media in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
674amnoncommon sand fly, lutzomyia gomezi, whole body, body proper, female, panama2020-09-28v4No1 / 27
674amnoncommon nyssomyia trapidoi, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 27
488amnondominant canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
651amnon high in female compared to male in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 28
154amnonstrongly correlated with high uranium concentration ( high in uranium high urnaium compared to control in soil australia kakadu national park sediment )2017-06-29v4No1 / 28
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
693amnon high in polycystic ovary syndrome compared to control in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 29
704amnon high in control compared to dental caries in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 29
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
651amnon high in male compared to female in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 31
674amnoncommon mosquito, culex coronator, whole body, body proper, female, panama2020-09-28v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 31
740amnon high in female female organism compared to male organism male in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 31
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
578amnon high in control compared to hiv infection in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
611amnon high in female compared to male in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 33
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 33
528amnon high in african american african compared to caucasian in united states of america pregnancy vagina female homo sapiens 2019-07-14v1No1 / 34
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 34
127amnonhigher in vaccinated chickens ( high in vaccination salmune vaccination compared to control in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 34
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
674amnoncommon psychodopygus panamensis, sand fly, whole body, body proper, female, panama2020-09-28v4No1 / 34
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 35
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 35
897amnon high in broiler chicken compared to isa brown layer chicken in male caecum age 4 weeks adelaide research facility australia gallus gallus chicken 2022-04-18v3No1 / 35
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 35
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 36
674amnoncommon culicoides helicaniae, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 36
674amnoncommon culex declarator, mosquito, whole body, body proper, female, panama2020-09-28v4No1 / 36
196amnonhigher in heated tap water 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in water drinking water united states of america )2017-09-12v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
399amnon high in ulcerative colitis compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 36
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 37
84amnondisappears in drought in late time points ( high in control compared to drought environment timepoint in depth 5cm soil temperate grassland biome fen peat soil flooded grassland biome united kingdom )2017-03-07v4No1 / 37
651amnon high in parkinson's disease compared to control in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 37
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 37
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 38
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v4No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 38
744amnoncommon ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
700amnon high in control compared to tylosin phosphate antibiotic in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 40
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 44
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v3No1 / 44
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 44
898amnoncommon descending colon, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 45
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v3No1 / 45
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in soil united states of america state of california depth 5cm )2017-07-25v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 47
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
744amnon high in ileum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
898amnoncommon anatomical space, ascending colon, coyote, canis latrans, edmonton, adult organism, wild, canada, male2022-04-19v4No1 / 47
96amnon high in periodontitis compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 48
674amnoncommon culicoides batesi, biting midge, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 48
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 48
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v3No1 / 48
495amnon high in typhlitis disease intestinal disease compared to control in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 48
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
674amnoncommon biting midge, culicoides foxi, culicoides <genus>, whole body, body proper, female, panama2020-09-28v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 49
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 50
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
898amnoncommon wild, feces, coyote, canis latrans, adult organism, male, edmonton, canada2022-04-19v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
16amnon high in control compared to diarrhea in felis catus state of california feces 2016-11-08v4No1 / 51
196amnonlower in biofilms in water at 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in biofilm drinking water united states of america water biofilm )2017-09-12v4No1 / 51
725amnoncommon control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 51
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
730amnon high in control compared to crohn's disease in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 52
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 52
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
897amnon high in isa brown layer chicken compared to broiler chicken in adelaide age 4 weeks chicken australia male gallus gallus caecum research facility 2022-04-18v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
102amnon high in periodontitis compared to control in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 53
162amnon high in periodontitis compared to control in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
196amnonlower in heated tap water 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in water drinking water united states of america )2017-09-12v4No1 / 54
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 55
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
898amnoncommon caecum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 55
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 56
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
423amnon high in male compared to female in bank vole myodes glareolus ukraine skin 2018-12-05v4No1 / 56
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v4No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens mucosa sinusoidal space paranasal sinus united states of america )2017-10-31v4No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 62
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in biofilm drinking water united states of america water biofilm )2017-09-12v4No1 / 62
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
695amnon high in sesame allergy compared to milk allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 64
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
77amnon high in depth 0.01-0.02 depth compared to depth 0.02-0.03 in kelp forest algae australia winter ecklonia radiata 2017-02-28v4No1 / 67
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v3No1 / 67
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common squamous esophagus, esophagus, esophageal disease, hospital, new york city, united states of america, homo sapiens)2028-03-11v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
744amnon high in cloaca compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 70
819amnon high in scalp compared to skin of cheek in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 70
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 70
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v4No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
914amnon high in control compared to diarrhea in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 71
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in gallus gallus chicken united states of america caecum )2017-04-14v4No1 / 72
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
697amnoncommon sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 73
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 73
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 78
898amnon high in descending colon ascending colon feces compared to jejunum duodenum in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
133amnonhigher in healthy babies (<1yr) compared to acute respiratory illness ( high in control compared to acute respiratory illness respiratory system disease in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 80
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
678amnon high in control compared to tooth disease black dental staining in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 82
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
133amnonlower in healthy babies (<1yr) compared to acute respiratory illness ( high in acute respiratory illness respiratory system disease compared to control in homo sapiens infant nasopharynx australia )2017-04-16v4No1 / 83
721amnon high in high protein diet weight loss weight loss diet compared to high fiber fiber diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 85
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
914amnon high in diarrhea compared to control in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 92
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 93
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
730amnoncommon control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 97
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 100
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
912amnon high in dead compared to alive in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 100
704amnon high in dental caries compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 102
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 106
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v3No1 / 113
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
744amnoncommon cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth (soil) 15cm depth compared to depth 2.5cm in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 120
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 121
744amnon high in ileum compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 121
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
636amnon high in oropharynx oropharyngeal swab compared to trachea endotracheal aspirate tracheal aspirate in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 122
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 129
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in anas platyrhynchos mallard state of california cloaca )2017-03-05v4No1 / 131
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
897amnoncommon broiler chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
63amnon high in female compared to male in homo sapiens skin 2017-02-15v4No1 / 139
744amnoncommon caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 141
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
897amnoncommon isa brown, layer chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 144
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 147
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
605amnon high in recurrent otitis media compared to control in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 149
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 150
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
678amnoncommon control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 163
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v3No1 / 185
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
744amnon high in caecum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 187
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 191
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 198
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
9amnonlower in sea water with coral ( high in control compared to porites astreoides in bermuda sea water )2016-10-27v4No1 / 211
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 225
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
916amnon high in antimicrobial agent antibiotics supllemented diet antibiotic compared to normal diet control in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 226
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v3No1 / 232
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v4No1 / 238
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 242
916amnon high in control diet control compared to antibiotics supllemented diet antibiotic in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 246
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth (soil) 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
744amnon high in cloaca compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 265
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
744amnon high in caecum compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 286
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 288
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
861amnon high in peri-urban community rural community bushbuckridge local municipality compared to city urban community soweto in human middle aged stage female south africa feces homo sapiens 2022-01-15v3No1 / 289
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in water lake lake erie united states of america freshwater lake fresh water )2017-10-29v4No1 / 301
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
902amnoncommon control, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 350
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in low fusarium cumulative disease incidence conventional tillage deep plough dazomet soil fumigation bio-organic fertilizer paenibacillus polymyxa paenibacillus compost soil pig manure compared to control high fusarium cumulative disease incidence in soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county )2021-04-18v4No1 / 360
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
560amnoncommon ceratotherium simum, white rhinoceros, ceratotherium simum simum, zoological garden, captive, united states of america, san diego zoo, female2019-11-04v4No1 / 373
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 394
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 402
495amnon high in control compared to typhlitis disease intestinal disease in gallus gallus chicken caecum kingdom of spain farm free range chicken 2019-03-03v4No1 / 412
560amnoncommon zoological garden, captive, united states of america, san diego zoo, female, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
166amnonhigher in river sediment under mussles compared to control ( high in mussel unionidae compared to control in freshwater biome river upper mississippi river mississippi river sediment united states of america depth 5cm )2017-07-18v4No1 / 422
698amnon high in ph 6-7 control compared to ph 5-6 disease plant disease acute oak decline in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 504
448amnoncommon in healthy horse feces (common equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v4No1 / 508
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum ceratotherium simum simum white rhinoceros in zoological garden captive united states of america san diego zoo female 2019-11-04v4No1 / 656
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in freshwater biome river upper mississippi river mississippi river sediment united states of america depth 5cm )2017-07-18v4No1 / 671
560amnon high in ceratotherium simum ceratotherium simum simum white rhinoceros compared to greater one-horned rhinoceros rhinoceros unicornis in zoological garden captive united states of america san diego zoo female 2019-11-04v4No1 / 677
902amnon high in control compared to salmonellosis salmonella gastroenteritis in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 679
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 698
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
232amnonlower in diabetec patient foot skin compared to healthy controls ( high in control compared to diabetes mellitus in homo sapiens skin australia foot )2017-11-05v4No1 / 708
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 811
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
448amnon high in control compared to equine grass sickness disease in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 1084
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
171amnon high in control compared to drought environment in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 1164
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1681
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735
902amnon high in control compared to antibiotics induced colitis antibiotic colitis colitis in adult organism united states of america feces horse equus caballus 2022-05-02v4No1 / 1755
507amnonlower in mine tailing contaminated sediment compared to uncontaminated control ( high in control compared to contaminated sediment in lake sediment sediment canada quesnel lake province of british columbia )2019-03-17v4No1 / 1825
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893

Problems / suggestions? Please email info AT dbbact DOT org