Summary for ontology term: metronidazole

Number of annotations with term: 13

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.375000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.375000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__MorganellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGATTGAGTCAGATGTGAAATCCCCGGGCTTAACCCGGGAATTGCATCTGATACTGGTCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCATG0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__ProteusTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCAATTAAGTCAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATCTGAAACTGGTTGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCATG0.250000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.250000
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGCGGCAAAATAAGTCTGAAGTAAAAGGCGTTGGCTCAACCAACGTAAGCTTTGGAAACTGTTAAGCTAGCGTGCAGGAGAGGTTAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACAGTTAAGTCAGCGGTAAAATTGAGAGGCTCAACCTCTTCCCGCCGTTGAAACTGATTGTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAGGCAAGTCAGATGTGAAATCCACAGGCTTAACCTGTGGCGTGCATTTGAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCGAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGCTTGCAAGTTGGAAGTGAAATCTCGGGGCTTAACCCCGAAACTGCTTTCAAAACTGCGAGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGACGGGCAAGTCTGATGTGAAAGCCCGGGGCTTAACCCCGGGACTGCATTGGAAACTGTCCATCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.285714

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTATGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGCCTGGCAAGTCCGCATTGAAAGGCATTGGCTTAACCAATGTTTGGTGCGGATACTATCAGGCTTGAGTAGATGAGGGGCAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGTTAATCAAGTCAGATGTGAAAGGCGAGGGCTCAACCCTCGTAAGCATTTGAAACTGATAAACTTGAGTAGTGAAGAGGTAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGACAGGTGTGAAATCCCAGGGCTTAACCTTGGAATTGCATTTGTGACTGCGGGACTAGAGTTCATCAGAGGGGGGTGGAATTCCAAG0.200000
d__BacteriaTACGTATGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTCAATTAAGTTTATCGTGAAAGCCCGGGGCTTAACCCCGGGATGCGGTAAAAACTGGCTGACTTGAGTAATGGAGGGGACAGTGGAATTCCTGGT0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Paenibacillaceae 1TACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTGTTTAAGTCTGGTGTTTAATCCTGGGGCTCAACTCCGGGTCGCACTGGAAACTGGGCAGCTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__HelcococcusTACGTATGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTAATTTAAGTCTGAATTAAAAGGCTGTGGCTCAACCATAGTAAGGTTCGGATACTGGATTACTTGAGTAGATGAGGGGAAAGTGGAATTCCATGT0.200000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__SphingobacteriumTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTATTAAGTCAGTGGTGAAAGACGGCAGCTCAACTGTCGCAGTGCCTTTGATACTGATGAGCTTGAATGTTGTTGAAGATGGCGGAATGAGACA0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ProteiniphilumTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCTCAGGCGGGCGATTAAGTCGGCGGTGAAATTTTGCGGCTCAACCGTAAAAGTGCCTTCGAAACTGGTCGCCTTGAGTGTGGATGAGGTAGGCGGAATTTGTGG0.200000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__MannheimiaTACGGGGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTGTTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGACAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.200000
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTCGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
metronidazole0.614035
LOWER IN metronidazole0.600000
LOWER IN antibiotic0.344828
antibiotic0.324324
vancomycin0.240000
neomycin0.240000
state of louisiana0.235294
LOWER IN vancomycin0.235294
state of texas0.137931
before antibiotics0.133333
LOWER IN amoxicillin0.133333
LOWER IN doxycycline0.133333
acute severe colitis0.133333
equus caballus0.129032
horse0.129032
c57bl/6j0.121212
LOWER IN neomycin0.117647
ulcerative colitis0.095238
state of california0.068376
dog0.067797
mouse0.062992
canis lupus familiaris0.061538
mus musculus0.057554
LOWER IN control0.050505
control0.050505
child0.040816
united states of america0.039617
research facility0.039088
feces0.037500
adult0.022556
homo sapiens0.014482
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN metronidazole0.857143
metronidazole0.714286
state of louisiana0.500000
LOWER IN vancomycin0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
acute severe colitis0.500000
LOWER IN antibiotic0.312500
antibiotic0.250000
vancomycin0.250000
neomycin0.250000
LOWER IN neomycin0.250000
ulcerative colitis0.125000
state of texas0.125000
equus caballus0.111111
horse0.111111
c57bl/6j0.100000
dog0.043478
canis lupus familiaris0.038462
state of california0.038462
mouse0.035088
mus musculus0.031746
child0.027778
LOWER IN control0.027027
control0.027027
research facility0.020408
united states of america0.020243
feces0.019108
adult0.011561
homo sapiens0.007380
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america0.923077
metronidazole0.538462
antibiotic0.461538
LOWER IN metronidazole0.461538
research facility0.461538
adult0.461538
LOWER IN control0.384615
control0.384615
LOWER IN antibiotic0.384615
homo sapiens0.384615
mus musculus0.307692
mouse0.307692
state of california0.307692
vancomycin0.230769
neomycin0.230769
canis lupus familiaris0.153846
dog0.153846
state of louisiana0.153846
c57bl/6j0.153846
LOWER IN vancomycin0.153846
equus caballus0.153846
state of texas0.153846
horse0.153846
LOWER IN neomycin0.076923
before antibiotics0.076923
LOWER IN amoxicillin0.076923
LOWER IN doxycycline0.076923
ulcerative colitis0.076923
child0.076923
acute severe colitis0.076923
Exp. ID User ID Description Date Region Flag Sequences
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698

Problems / suggestions? Please email info AT dbbact DOT org