Summary for ontology term: mexico

Number of annotations with term: 68

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.014925
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.014925
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCGGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCATGGGCTCAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.014925
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.014925

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGAGATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTTTCCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTTTTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGAGGACTTGAGTATGTTTGAGGTAGGCGGAATGCGTGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTGGATCTTGAGTGTCGGAGGGGCAATCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGCTGCAAGTCAGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTTGAAACTGTGGCTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTGCGCAGGCGGTCTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACGGAAACTGGGAGACTGGAGTATCGGAGAGGAAAGCAGAATTCCTAGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGGCAGGCCGGGAGTCAAATCCGGGGGCTCAACCCCCGCCCGCTCCCGGAACCTTTAGGCTTGAGTCTGGCAGGGGAGGGTGGAATACCCGGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTTTTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Rubrobacterales;f__Rubrobacteraceae;g__RubrobacterTACGTAGGGGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGTTCGGTAAGTCTGTCGTGAAATCCTGAGGCTCAACCTCGGACGTGCGATGGATACTGCCGGGCTAGAGGATGGTAGAGGCGAGTGGAATTCCCGG0.238095
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGATCTGTAAGTCAGTGGTGAAATCTCCAAGCTTAACTTGGAAACTGCCGTTGATACTATAGATCTTGAATGCTGTGGAGGTGAGCGGAATATGTCA0.236559
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCGGTCCTGCAAGTCTTCCGTTAAATCCAGCTGCTCAACAGATGGGCTGCGGAGGATACTACAGGGCTAGGAGGCGGGAGAGGCAAGCGGTACTTTATG0.222222
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3TACGTAGGCAGCGAGCGTTGTTCGGAGTTACTGGGCGTAAAGCGTGCGTAGGCGGTGTCTTAAGTTTGTTGTGAAATCTCCCGGCTTAACCGGGAGGGTGCGGCGAATACTGAGATGCTGGAGTGCGGGAGAGGTAAGCGGAATTCCTGG0.217391
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGCAGTTAAGTCAGTGGTGAAATCTCCGGGCTTAACCCGGAAACTGCCATTGATACTATCTGTCTTGAATGTCGTGGAGGTAAGCGGAATATGTCA0.214286
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__SegetibacterTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGTTGGTAAGTCAGTGGTGAAATCTCCGTGCTTAACATGGAAACTGCCATTGATACTACTGATCTTGAATTTTCTGGAGGTAAGCGGAATATGTCA0.210526
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGTTCGGTAAGTCTGCCGTGAAAACCTGGGGCTCAACCCCAGGCGTGCGGTGGATACTGCCGGGCTAGAGGGTGGTAGAGGCGAGTGGAATTCCCGG0.209302
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACG0.205128
d__Bacteria;p__"Actinobacteria"TACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGCGTAGGCGGCCCGATAAGTCCGCTGTGAAAGTCAAGGGCTTAACCCTTGAATGCCGGTGGAAACTGTCGGGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.204545
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCACGACAAGTCGCTTGTGAAATCTCCGGGCTTAACTCGGAGCGGCCAAGCGATACTGTCGCGCTAGAGTGCGGAAGGGGCAACTGGAATTCTCGG0.202532

Annotations:

common ontology terms
term enrichment score
TermScore
mexico0.920319
guanajuato0.403509
cactus0.363636
agave0.358491
desert0.336538
myrtillocactus geometrizans0.260870
opuntia robusta0.260870
semi-arid0.230769
cocoa mass0.190476
theobroma cacao0.190476
state of tabasco0.190476
agave salmiana0.190476
agave tequiliana0.190476
pet0.150000
ph 6-6.50.150000
cultivated environment0.141026
decaying0.128205
leaf0.127660
leaf surface0.113636
canis lupus baileyi0.111111
leaf endosphere0.095238
root endosphere0.095238
bird0.082192
drosophila nigrospiracula0.081081
time 5 days0.081081
fermented cocoa mass0.081081
drosophila0.077922
fly0.075000
rhizosphere0.069444
municipality of timilpan0.057143
municipality of suchil0.057143
captive0.057143
serinus canaria0.055556
canary0.055556
carnegiea gigantea0.055556
saguaro0.055556
pachycereus pringlei0.055556
cardon0.055556
cocoa strain criollo0.055556
cocoa strain forasterio0.055556
raw meat diet0.055556
dog food diet0.055556
melopsittacus undulatus0.055556
parakeet0.055556
nymphicus hollandicus0.055556
cockatiel0.055556
root zone soil0.055556
state of california0.053571
hispanic or latin american0.052632
body proper0.044444
soil0.037539
LOWER IN rhizosphere0.035714
lima0.028986
LOWER IN spring0.028986
spring0.028986
LOWER IN cuba0.028986
cuba0.028986
LOWER IN decaying0.028571
LOWER IN drosophila nigrospiracula0.028571
LOWER IN time 5 days0.028571
LOWER IN fermented cocoa mass0.028571
shantytown0.028571
LOWER IN el salado0.028571
LOWER IN agave0.028571
leaf interior0.028571
root interior0.028571
LOWER IN cactus0.028169
LOWER IN drosophila0.028169
time 00.028169
LOWER IN time 00.028169
LOWER IN fly0.027778
LOWER IN small village0.027778
LOWER IN leaf surface0.027778
LOWER IN soil0.027714
LOWER IN mexico0.026316
feces0.023886
city0.022727
LOWER IN leaf0.022727
summer0.021978
LOWER IN summer0.021978
homo sapiens0.012645
adult0.009662
united states of america0.007117
root0.005609
mexican wolf0.000000
ocotal state park0.000000
la michilia biosphere reserve0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
municipality of timilpan1.000000
canis lupus baileyi1.000000
municipality of suchil1.000000
lima1.000000
LOWER IN spring1.000000
spring1.000000
LOWER IN cuba1.000000
cuba1.000000
mexico0.875000
cactus0.666667
pet0.500000
serinus canaria0.500000
canary0.500000
drosophila nigrospiracula0.500000
carnegiea gigantea0.500000
saguaro0.500000
decaying0.500000
pachycereus pringlei0.500000
cardon0.500000
LOWER IN decaying0.500000
LOWER IN drosophila nigrospiracula0.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
cocoa strain criollo0.500000
cocoa strain forasterio0.500000
time 5 days0.500000
fermented cocoa mass0.500000
raw meat diet0.500000
dog food diet0.500000
LOWER IN time 5 days0.500000
LOWER IN fermented cocoa mass0.500000
shantytown0.500000
LOWER IN el salado0.500000
guanajuato0.500000
agave0.500000
agave salmiana0.500000
melopsittacus undulatus0.500000
parakeet0.500000
agave tequiliana0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
LOWER IN agave0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
ph 6-6.50.500000
root zone soil0.500000
leaf interior0.500000
root interior0.500000
drosophila0.333333
LOWER IN cactus0.333333
LOWER IN drosophila0.333333
time 00.333333
LOWER IN time 00.333333
semi-arid0.333333
desert0.250000
fly0.250000
LOWER IN fly0.250000
LOWER IN small village0.250000
leaf endosphere0.250000
root endosphere0.250000
leaf surface0.250000
LOWER IN leaf surface0.250000
hispanic or latin american0.250000
cultivated environment0.125000
LOWER IN mexico0.125000
leaf0.100000
body proper0.090909
bird0.076923
captive0.055556
city0.050000
LOWER IN leaf0.050000
rhizosphere0.045455
LOWER IN rhizosphere0.045455
summer0.043478
LOWER IN summer0.043478
state of california0.038462
LOWER IN soil0.020202
soil0.020202
feces0.012739
homo sapiens0.007380
adult0.005780
united states of america0.004049
root0.002915
mexican wolf0.000000
ocotal state park0.000000
la michilia biosphere reserve0.000000
Fraction of annotations for the query sequences containing the term
TermScore
mexico0.970588
desert0.514706
guanajuato0.338235
agave0.279412
soil0.264706
cactus0.250000
feces0.191176
leaf0.176471
myrtillocactus geometrizans0.176471
opuntia robusta0.176471
semi-arid0.176471
cultivated environment0.161765
rhizosphere0.147059
cocoa mass0.117647
theobroma cacao0.117647
state of tabasco0.117647
agave salmiana0.117647
agave tequiliana0.117647
bird0.088235
pet0.088235
state of california0.088235
ph 6-6.50.088235
decaying0.073529
root0.073529
leaf surface0.073529
captive0.058824
canis lupus baileyi0.058824
mexican wolf0.058824
leaf endosphere0.058824
root endosphere0.058824
drosophila0.044118
drosophila nigrospiracula0.044118
fly0.044118
time 5 days0.044118
fermented cocoa mass0.044118
homo sapiens0.044118
LOWER IN soil0.044118
serinus canaria0.029412
canary0.029412
body proper0.029412
carnegiea gigantea0.029412
saguaro0.029412
pachycereus pringlei0.029412
cardon0.029412
cocoa strain criollo0.029412
cocoa strain forasterio0.029412
municipality of timilpan0.029412
raw meat diet0.029412
ocotal state park0.029412
municipality of suchil0.029412
dog food diet0.029412
la michilia biosphere reserve0.029412
melopsittacus undulatus0.029412
parakeet0.029412
nymphicus hollandicus0.029412
cockatiel0.029412
LOWER IN rhizosphere0.029412
united states of america0.029412
adult0.029412
hispanic or latin american0.029412
root zone soil0.029412
LOWER IN cactus0.014706
LOWER IN decaying0.014706
LOWER IN drosophila0.014706
LOWER IN drosophila nigrospiracula0.014706
LOWER IN fly0.014706
time 00.014706
LOWER IN time 5 days0.014706
LOWER IN fermented cocoa mass0.014706
LOWER IN time 00.014706
lima0.014706
shantytown0.014706
LOWER IN el salado0.014706
LOWER IN small village0.014706
city0.014706
LOWER IN leaf0.014706
LOWER IN leaf surface0.014706
LOWER IN agave0.014706
summer0.014706
LOWER IN spring0.014706
spring0.014706
LOWER IN summer0.014706
LOWER IN cuba0.014706
cuba0.014706
LOWER IN mexico0.014706
leaf interior0.014706
root interior0.014706
Exp. ID User ID Description Date Region Flag Sequences
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato2018-08-21v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 6
129amnondominant rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 8
864amnondominant feces, mexico, captive, municipality of timilpan, canis lupus baileyi, raw meat diet, mexican wolf, ocotal state park2022-02-08v3No1 / 9
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 9
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 9
129amnondominant soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 9
360amnondominant desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 10
302amnonhigh freq. in feces of canary pet birds (dominant feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 11
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 12
360amnondominant desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 12
129amnondominant leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 12
789amnondominant in traditionally harvested cocoa pulp before fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain criollo)2021-06-01v3No1 / 13
789amnondominant in traditionally harvested cocoa pulp before fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain forasterio)2021-06-01v3No1 / 13
360amnondominant desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 13
302amnonhigh freq. in feces of Cockatiel pet birds (dominant feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
360amnondominant desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 14
129amnon high in rhizosphere compared to soil in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 14
129amnonfound INSIDE leaves of cactus (common leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf interior)2017-04-15v4No1 / 14
201amnonhigh freq. in decaying Saguaro cactus (dominant desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 15
201amnonhigh freq. in decaying Cardon cactus (dominant desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 15
360amnondominant desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave salmiana2018-08-21v4No1 / 15
360amnondominant desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 16
360amnondominant desert, mexico, guanajuato, agave, agave tequiliana, root endosphere, cultivated environment, root2018-08-21v4No1 / 17
302amnonhigh freq. in feces of parakeet pet birds (dominant feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 18
864amnondominant feces, mexico, captive, municipality of suchil, canis lupus baileyi, dog food diet, mexican wolf, la michilia biosphere reserve2022-02-08v3No1 / 21
201amnonhigh freq. in cactus fly whole body (dominant desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 22
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
864amnoncommon feces, mexico, captive, municipality of suchil, canis lupus baileyi, dog food diet, mexican wolf, la michilia biosphere reserve2022-02-08v3No1 / 35
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave salmiana2018-08-21v4No1 / 39
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
302amnoncommon in feces of parakeet pet birds (common feces, melopsittacus undulatus, mexico, bird, parakeet, pet)2018-03-05v4No1 / 44
302amnoncommon in feces of canary pet birds (common feces, mexico, bird, pet, serinus canaria, canary)2018-03-05v4No1 / 47
864amnoncommon feces, mexico, captive, municipality of timilpan, canis lupus baileyi, raw meat diet, mexican wolf, ocotal state park2022-02-08v3No1 / 53
360amnoncommon desert, mexico, guanajuato, agave, agave tequiliana, root endosphere, cultivated environment, root2018-08-21v4No1 / 62
302amnoncommon in feces of Cockatiel pet birds (common feces, mexico, bird, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
789amnoncommon in traditionally harvested cocoa pulp before fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain criollo)2021-06-01v3No1 / 67
360amnoncommon desert, leaf, mexico, guanajuato, agave, leaf endosphere, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
789amnoncommon in traditionally harvested cocoa pulp before fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, cocoa strain forasterio)2021-06-01v3No1 / 82
360amnoncommon desert, mexico, guanajuato, agave, root endosphere, agave salmiana, root2018-08-21v4No1 / 87
360amnon high in spring compared to summer in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 97
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
201amnoncommon in cactus fly whole body (common desert, body proper, drosophila, mexico, drosophila nigrospiracula, fly)2017-10-01v4No1 / 101
201amnonlower in cactus fly compared to decaying cactus ( high in cactus decaying compared to drosophila drosophila nigrospiracula fly in desert mexico )2017-10-01v4No1 / 114
789amnonhigh in unfemented compared to fermented cocoa mass ( high in time 0 compared to time 5 days fermented cocoa mass in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 121
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
201amnoncommon in decaying Saguaro cactus (common desert, mexico, cactus, carnegiea gigantea, saguaro, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common desert, mexico, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave tequiliana, leaf surface, cultivated environment2018-08-21v4No1 / 210
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila drosophila nigrospiracula fly compared to cactus decaying in desert mexico )2017-10-01v4No1 / 215
129amnon high in soil compared to rhizosphere in mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid ph 6-6.5 2017-04-15v4No1 / 221
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
129amnoncommon rhizosphere, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 338
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
360amnoncommon desert, soil, rhizosphere, mexico, guanajuato, agave, agave salmiana2018-08-21v4No1 / 484
360amnoncommon desert, leaf, mexico, guanajuato, agave, agave salmiana, leaf surface2018-08-21v4No1 / 492
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
129amnoncommon leaf, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid2017-04-15v4No1 / 562
360amnon high in rhizosphere agave compared to soil in desert state of california mexico 2018-08-21v4No1 / 593
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, ph 6-6.52017-04-15v4No1 / 884
129amnoncommon soil, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root zone soil, ph 6-6.52017-04-15v4No1 / 968
360amnon high in soil compared to rhizosphere agave in desert state of california mexico 2018-08-21v4No1 / 992
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108

Problems / suggestions? Please email info AT dbbact DOT org