Summary for ontology term: monkey

Number of annotations with term: 100

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTGTCAAGTCAGGGGTGAAATACCGCAGCTCAACTGTGGAATTGCCTTTGATACTGGCAGGCTTGAATACTGTTGCCGTGGGAGGAATGAGTAG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTTAACCCCGCGGATTGCTTTTGGAACTGTCTGGCTAGAGTGCAGGAGGGGCAGGCGGAATTCCTA0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTATAAAGGGAGCGCAGGCGGGAGAGCAAGTCAGCGGTGAAATACATGGGCTTAACCCATGAACTGCCGTTGAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCGAG0.010000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.010000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.010000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGTGTAAAGCGTGTGTAGGCGGTTTCGTAAGTCTAAGGTTAAAGCCCGGAGCTCAACTCCGGTTCGCCTTAGAAACTGCGTCACTTGAGTATGGTAGAGGCAAATGGAATTTCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGAAGTGAAATGCGGGGGCTCAACCCCTGAACTGCTTTGGAAACTGTCAGGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTCTTAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGATTGGCAAGTTGGGAGTGAAATGTCGGGGCTTAACCCCGGAACTGCTTCCAAAACTGTTGATCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.325359
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCATCGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCGGAGCTAGAGTGCAGGAGGGGCAAGTGGAATTCCTAG0.321678
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAATGCAAGTTGGATGTGAAATACCGCAGCTTAACTGCGGAGCTGCATCCAAAACTGTGTTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG0.303030
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATGCTAAGGCTTAACCATAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.288000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGCAGGCGGGATAGCAAGTCAGATGTGAAATGCTATGGCTTAACCATAGAACTGCATTTGAAACTGCTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTCTTATAAGCGTGACGTGAAATGCAGCGGCTCAACCGTATGATGTGCGTCGCGAACTGTAGGACTTGAGTGTATTCGATGTCAGCGGAATTTGTG0.283688
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATGCAAGTCTGAAGTGAAAGGACGGGGCTTAACCCTGTGACTGCTTTGGAAACTGTGTAGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.282486
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTATTCGGAATTATTGGGCGTAAAGGGCACGCAGGCGGCTTTGCAAGCTTGGTGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTGAGAACTGCATGGCTAGAGTTAGTGAGGGGAAACCGGAATTCCAGG0.282353
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGACCCGCAAGTCAGGTGTGAAATCCATGGGCTCAACCCATGAACTGCACTTGAAACTGTGGGCCTTGAGTGATGGAGAGGCAGGCGGAATTCCCGG0.268657
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTAATACAAGCTTGGTGTGAAATACCTGGGCTTAACTCAGGAACTGCGTTGAGAACTGTATTACTAGAGTAGCTGAGGGGCAACCGGAATTCCAGG0.264463

Annotations:

common ontology terms
term enrichment score
TermScore
monkey0.754717
macaca mulatta0.575916
rhesus macaque0.324324
zoological garden0.283871
wild0.223048
chimpanzee0.221591
captive0.214286
ethiopia0.166667
puerto rico0.166667
pan troglodytes0.156522
gorilla gorilla0.152542
zambia0.137931
pan troglodytes troglodytes0.126697
cebus capucinus0.110092
white-faced capuchin0.110092
age 8 months0.107143
cameroon0.101695
costa rica0.096774
state of washington0.096774
papio anubis0.093023
papio kindae0.090909
republic of congo0.090909
nouabale-ndoki national park0.090909
age 12-23 years0.090909
age 1-7 years0.086957
age 1 month0.086957
3-month-old human stage0.084507
subgingival plaque0.083333
macaque0.075472
olive baboon0.075472
kinda baboon0.074074
chlorocebus aethiops0.074074
theropithecus gelada0.074074
feces0.073252
LOWER IN zoological garden0.066667
state of tennessee0.066667
LOWER IN state of oregon0.064516
state of oregon0.064516
dentition0.060606
neonate0.058252
LOWER IN pan troglodytes troglodytes0.057416
age 6 months0.056604
papio ursinus0.056604
pan troglodytes verus0.056604
central chimpanzee0.056604
age 1 week0.053571
research facility0.051110
juvenile organism0.050847
LOWER IN wild0.048387
united states of america0.045985
state of california0.039216
LOWER IN state of california0.039216
LOWER IN age 8 months0.038462
grayfoot chacma baboon0.038462
chlorocebus djamdjamensis0.038462
bale monkey0.038462
grivet monkey0.038462
vervet monkey0.038462
lincoln park zoo0.038462
saint louis0.038462
saint louis zoo0.038462
toronto zoo0.038462
induced periodontitis0.038462
LOWER IN induced periodontitis0.038462
western chimpanzee0.038462
papio0.037736
baboon0.037736
chicago0.037736
wet season0.037736
LOWER IN dry season0.037736
dry season0.037736
LOWER IN wet season0.037736
LOWER IN cameroon0.037736
periodontitis0.037037
LOWER IN periodontitis0.037037
gorilla0.035714
child0.035714
LOWER IN 3-month-old human stage0.035088
woodland area0.033333
french republic0.031746
LOWER IN captive0.029412
canada0.026667
skin0.024096
female0.024096
africa0.022727
adult0.020725
LOWER IN neonate0.019802
LOWER IN age 6 months0.019608
LOWER IN papio kindae0.019608
LOWER IN papio ursinus0.019608
LOWER IN republic of congo0.019608
LOWER IN nouabale-ndoki national park0.019608
low human contact0.019608
LOWER IN age 12-23 years0.019608
LOWER IN pan troglodytes verus0.019608
LOWER IN central chimpanzee0.019608
LOWER IN low human contact0.019608
LOWER IN papio anubis0.019417
LOWER IN human contact0.019417
LOWER IN age 1-7 years0.019417
Fraction of dbbact annotations with this term covered by the query
TermScore
neonate1.000000
LOWER IN neonate1.000000
macaca mulatta0.833333
chimpanzee0.750000
monkey0.714286
papio anubis0.666667
macaque0.666667
olive baboon0.666667
cebus capucinus0.666667
white-faced capuchin0.666667
pan troglodytes troglodytes0.666667
LOWER IN pan troglodytes troglodytes0.666667
pan troglodytes0.600000
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
zambia0.500000
papio kindae0.500000
papio ursinus0.500000
kinda baboon0.500000
grayfoot chacma baboon0.500000
ethiopia0.500000
chlorocebus djamdjamensis0.500000
bale monkey0.500000
chlorocebus aethiops0.500000
grivet monkey0.500000
vervet monkey0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
lincoln park zoo0.500000
saint louis0.500000
saint louis zoo0.500000
toronto zoo0.500000
gorilla gorilla0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
low human contact0.500000
puerto rico0.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN central chimpanzee0.500000
theropithecus gelada0.500000
LOWER IN low human contact0.500000
zoological garden0.400000
papio0.333333
baboon0.333333
LOWER IN papio anubis0.333333
chicago0.333333
LOWER IN human contact0.333333
age 1-7 years0.333333
LOWER IN age 1-7 years0.333333
wet season0.333333
LOWER IN dry season0.333333
dry season0.333333
LOWER IN wet season0.333333
cameroon0.333333
LOWER IN cameroon0.333333
LOWER IN eastern chimpanzee0.333333
eastern chimpanzee0.333333
human contact0.333333
age 1 month0.333333
LOWER IN age 1 month0.333333
costa rica0.250000
LOWER IN chimpanzee0.250000
periodontitis0.250000
LOWER IN periodontitis0.250000
state of washington0.250000
age 1 week0.250000
LOWER IN age 1 week0.250000
wild0.208333
LOWER IN zoological garden0.200000
state of tennessee0.200000
LOWER IN pan troglodytes0.200000
captive0.166667
LOWER IN gorilla gorilla0.166667
gorilla0.166667
juvenile organism0.166667
LOWER IN juvenile organism0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
3-month-old human stage0.142857
LOWER IN 3-month-old human stage0.142857
LOWER IN wild0.125000
woodland area0.100000
french republic0.076923
subgingival plaque0.071429
LOWER IN captive0.055556
dentition0.043478
canada0.040000
state of california0.038462
Fraction of annotations for the query sequences containing the term
TermScore
feces0.880000
monkey0.800000
macaca mulatta0.440000
united states of america0.430000
research facility0.420000
captive0.300000
rhesus macaque0.240000
wild0.240000
zoological garden0.220000
chimpanzee0.130000
ethiopia0.100000
dentition0.100000
adult0.100000
puerto rico0.100000
subgingival plaque0.100000
pan troglodytes0.090000
gorilla gorilla0.090000
zambia0.080000
pan troglodytes troglodytes0.070000
3-month-old human stage0.060000
age 8 months0.060000
costa rica0.060000
cebus capucinus0.060000
white-faced capuchin0.060000
cameroon0.060000
europe0.060000
state of washington0.060000
papio anubis0.050000
papio kindae0.050000
republic of congo0.050000
nouabale-ndoki national park0.050000
age 12-23 years0.050000
child0.050000
age 1-7 years0.050000
age 1 month0.050000
female0.050000
LOWER IN zoological garden0.040000
kinda baboon0.040000
state of tennessee0.040000
macaque0.040000
chlorocebus aethiops0.040000
olive baboon0.040000
theropithecus gelada0.040000
state of california0.040000
LOWER IN state of oregon0.040000
state of oregon0.040000
LOWER IN state of california0.040000
age 6 months0.030000
LOWER IN wild0.030000
papio ursinus0.030000
LOWER IN pan troglodytes troglodytes0.030000
pan troglodytes verus0.030000
central chimpanzee0.030000
juvenile organism0.030000
age 20 months0.030000
age 1 week0.030000
neonate0.030000
LOWER IN age 8 months0.020000
LOWER IN 3-month-old human stage0.020000
papio0.020000
baboon0.020000
grayfoot chacma baboon0.020000
chlorocebus djamdjamensis0.020000
bale monkey0.020000
grivet monkey0.020000
vervet monkey0.020000
africa0.020000
woodland area0.020000
chicago0.020000
lincoln park zoo0.020000
saint louis0.020000
saint louis zoo0.020000
skin0.020000
canada0.020000
toronto zoo0.020000
french republic0.020000
gorilla0.020000
LOWER IN adult0.020000
induced periodontitis0.020000
periodontitis0.020000
LOWER IN control0.020000
control0.020000
LOWER IN induced periodontitis0.020000
LOWER IN periodontitis0.020000
wet season0.020000
LOWER IN dry season0.020000
dry season0.020000
LOWER IN wet season0.020000
LOWER IN captive0.020000
LOWER IN europe0.020000
LOWER IN cameroon0.020000
western chimpanzee0.020000
LOWER IN age 6 months0.010000
LOWER IN papio kindae0.010000
LOWER IN papio ursinus0.010000
LOWER IN papio anubis0.010000
LOWER IN gorilla gorilla0.010000
LOWER IN chimpanzee0.010000
LOWER IN republic of congo0.010000
LOWER IN nouabale-ndoki national park0.010000
Exp. ID User ID Description Date Region Flag Sequences
274amnondominant feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 6
274amnondominant feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 8
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
411amnondominant feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
274amnondominant feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
729amnondominant feces, zoological garden, gorilla gorilla, monkey, europe2021-01-05v3No1 / 11
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
592amnondominant feces, pan troglodytes, africa, wild, chimpanzee2020-02-18v1No1 / 12
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
876amnondominant feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 14
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 15
406amnondominant feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
729amnondominant feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
411amnondominant feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 16
399amnondominant feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 16
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
407amnondominant feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 16
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
729amnondominant feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 17
331amnondominant feces, ethiopia, monkey, theropithecus gelada2018-05-13v4No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
729amnondominant feces, zoological garden, monkey, captive, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
620amnondominant feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 28
876amnoncommon feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 30
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
407amnoncommon feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 34
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common feces, costa rica, monkey, cebus capucinus, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
407amnon high in wet season compared to dry season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 79
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
592amnoncommon feces, pan troglodytes, africa, wild, chimpanzee2020-02-18v1No1 / 130
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
331amnon high in dry season compared to wet season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 232
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
331amnoncommon feces, ethiopia, monkey, theropithecus gelada2018-05-13v4No1 / 298
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, grivet monkey2018-01-16v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
274amnoncommon feces, ethiopia, monkey, chlorocebus djamdjamensis, bale monkey2018-01-16v4No1 / 489
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
331amnon high in wet season compared to dry season in feces ethiopia monkey theropithecus gelada 2018-05-13v4No1 / 818
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065

Problems / suggestions? Please email info AT dbbact DOT org