Summary for ontology term: mouse

Number of annotations with term: 407

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.503226
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCACGGGCTCAACCCGTGAACTGCATTTGAAACTGTTTCCCTTGAGTGTCGGAGAGGTAATCGGAATTCCTTG0.458484
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.419014
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.418605
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTTGACAAGTCAGATGTGAAATCCTGCGGCTTAACCGCAGAACTGCATTTGAAACTGTTGATCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.414679
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCGGCTAGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.413793
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCGGCAAGTCTGAAGTGAAAGGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTGCCATGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.386364
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.385507
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTAGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.383659
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGACGTGAAATTCCAGGGCTCAACCCTGGAACTGCGTTTGAAACTGTTCTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.380776

Annotations:

common ontology terms
term enrichment score
TermScore
mouse0.989702
mus musculus0.938120
c57bl/60.509992
research facility0.486545
united states of america0.233074
c57bl/6j0.227810
feces0.216111
high fat diet0.189717
mouse chow0.181756
female0.171731
jackson laboratories0.156308
caecum0.149333
balb/c0.146853
diet0.105559
control0.104791
male0.103014
age 8 weeks0.101761
LOWER IN control0.099254
charles river laboratories0.083527
canada0.077010
colon0.076628
LOWER IN mouse chow0.075460
taconic farms0.074708
united kingdom0.071813
swiss webster0.065421
antibiotic0.064655
manchester0.064368
state of texas0.061719
age 18 weeks0.060961
state of georgia0.060475
LOWER IN high fat diet0.057143
south korea0.054687
brazil0.053950
female organism0.052533
male organism0.048880
sweden0.048880
janvier labs0.046838
germany0.043088
ketogenic diet0.042654
age 6 weeks0.041475
state of florida0.038523
iron supplemented diet0.038308
iron deficient diet0.038308
age 9 months0.037825
terminal ileum0.036446
right colon0.035794
LOWER IN antibiotic0.035372
state of illinois0.035165
state of oregon0.034557
cecal content0.034557
low fat diet0.033533
jackson laboratory0.033254
ldlr -/-0.033254
ldlr-0.033254
colonic mucosa0.033254
strain 129s0.033254
c3h/hej0.033254
japan0.032949
control diet0.031343
LOWER IN feces0.030820
state of washington0.030702
israel0.030011
LOWER IN c57bl/60.028951
c57bl/6ncrl0.028640
nzb/w f10.028640
colonized germ free0.028640
seattle0.028640
high sugar diet0.028640
ileum0.028623
streptomycin0.028235
state of maryland0.027842
wild0.027137
state of ohio0.027088
finland0.026374
state of california0.024427
LOWER IN jackson laboratories0.024174
db/db mouse0.023981
LOWER IN late timepoints0.023909
fasting0.023838
age 9 weeks0.023697
adult organism0.023301
obese body mass index status0.022883
obesity0.020747
australia0.020443
LOWER IN iron deficient diet0.019402
LOWER IN iron supplemented diet0.019402
LOWER IN taconic farms0.019370
humanized mouse0.019370
LOWER IN balb/c0.019370
western diet0.019370
LOWER IN fasting0.019339
nod mouse0.019277
house mice0.019277
cf-10.019277
icr/cd-1 mice0.019277
state of montana0.019093
early timepoints0.019093
state of iowa0.019093
new york city0.018391
age0.018391
Fraction of dbbact annotations with this term covered by the query
TermScore
mouse0.984375
LOWER IN mouse chow0.937500
mouse chow0.928571
high fat diet0.928571
LOWER IN high fat diet0.923077
c57bl/60.913043
c57bl/6j0.909091
mus musculus0.887324
jackson laboratories0.857143
LOWER IN c57bl/60.800000
balb/c0.777778
taconic farms0.750000
LOWER IN jackson laboratories0.750000
charles river laboratories0.750000
LOWER IN iron deficient diet0.750000
iron supplemented diet0.750000
LOWER IN iron supplemented diet0.750000
iron deficient diet0.750000
LOWER IN taconic farms0.666667
humanized mouse0.666667
LOWER IN age 18 weeks0.666667
age 18 weeks0.666667
LOWER IN age 6 weeks0.666667
LOWER IN balb/c0.666667
LOWER IN c57bl/6j0.666667
LOWER IN low fat diet0.666667
low fat diet0.666667
swiss webster0.666667
LOWER IN western diet0.666667
western diet0.666667
LOWER IN fasting0.600000
LOWER IN ketogenic diet0.600000
ketogenic diet0.600000
jackson laboratory0.500000
ldlr -/-0.500000
c57bl/6 t1r2-ko0.500000
LOWER IN c57bl/6 t1r2-ko0.500000
LOWER IN terminal ileum0.500000
LOWER IN ampicillin0.500000
glucose diet0.500000
LOWER IN glucose diet0.500000
inulin0.500000
ldlr-0.500000
linoleic acid0.500000
LOWER IN digestive tract0.500000
digestive tract0.500000
nod mouse0.500000
LOWER IN experimental autoimmune encephalomyelitis0.500000
experimental autoimmune encephalomyelitis0.500000
experimental cerebral malaria0.500000
malaria0.500000
dss induced colitis0.500000
LOWER IN dss induced colitis0.500000
LOWER IN il-1alpha knockout0.500000
il-1alpha knockout0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
manhatten region0.500000
LOWER IN queens region0.500000
manchester0.500000
skh-1 hairless mouse0.500000
colonic mucosa0.500000
LOWER IN age 9 weeks0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
zinc deficiency0.500000
low zinc diet0.500000
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
LOWER IN cefoperazone0.500000
cefoperazone0.500000
cba/j mice0.500000
LOWER IN dextran sulfate sodium0.500000
LOWER IN dss0.500000
LOWER IN every other day fasting0.500000
every other day fasting0.500000
c57bl/6ncrl0.500000
high fat diet + polydextrose0.500000
polydextrose0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
harlan sprague dawley0.500000
LOWER IN harlan spague dawley0.500000
a/j0.500000
LOWER IN a/j0.500000
LOWER IN age 24 weeks0.500000
age 24 weeks0.500000
bangladesh diet0.500000
LOWER IN bangladesh diet0.500000
LOWER IN db/db mouse0.500000
db/db mouse0.500000
LOWER IN ain-93g rodent diet0.500000
quinoa food product0.500000
ain-93g rodent diet0.500000
LOWER IN quinoa food product0.500000
strain 129s0.500000
nih 31m chow0.500000
Fraction of annotations for the query sequences containing the term
TermScore
mouse0.995086
mus musculus0.995086
research facility0.928747
feces0.695332
united states of america0.587224
c57bl/60.353808
female0.159705
caecum0.137592
c57bl/6j0.130221
high fat diet0.105651
mouse chow0.100737
control0.093366
jackson laboratories0.085995
LOWER IN control0.085995
canada0.083538
balb/c0.081081
male0.076167
age 8 weeks0.063882
diet0.061425
colon0.049140
united kingdom0.049140
charles river laboratories0.044226
taconic farms0.039312
LOWER IN mouse chow0.039312
antibiotic0.036855
brazil0.034398
manchester0.034398
south korea0.034398
state of texas0.034398
swiss webster0.034398
state of georgia0.034398
female organism0.034398
age 18 weeks0.031941
LOWER IN high fat diet0.029484
male organism0.029484
state of florida0.029484
germany0.029484
sweden0.029484
japan0.024570
wild0.024570
janvier labs0.024570
age 6 weeks0.022113
ketogenic diet0.022113
right colon0.019656
ileum0.019656
terminal ileum0.019656
LOWER IN antibiotic0.019656
state of oregon0.019656
iron supplemented diet0.019656
iron deficient diet0.019656
state of california0.019656
age 9 months0.019656
cecal content0.019656
state of illinois0.019656
jackson laboratory0.017199
ldlr -/-0.017199
LOWER IN feces0.017199
ldlr-0.017199
state of washington0.017199
israel0.017199
colonic mucosa0.017199
strain 129s0.017199
low fat diet0.017199
control diet0.017199
c3h/hej0.017199
state of ohio0.014742
LOWER IN c57bl/60.014742
adult0.014742
state of maryland0.014742
c57bl/6ncrl0.014742
finland0.014742
streptomycin0.014742
adult organism0.014742
nzb/w f10.014742
australia0.014742
colonized germ free0.014742
seattle0.014742
high sugar diet0.014742
LOWER IN jackson laboratories0.012285
age 9 weeks0.012285
fasting0.012285
obese body mass index status0.012285
db/db mouse0.012285
obesity0.012285
LOWER IN late timepoints0.012285
LOWER IN taconic farms0.009828
humanized mouse0.009828
nod mouse0.009828
house mice0.009828
new york city0.009828
city0.009828
LOWER IN fasting0.009828
tongue0.009828
LOWER IN balb/c0.009828
age0.009828
LOWER IN iron deficient diet0.009828
state of montana0.009828
LOWER IN iron supplemented diet0.009828
early timepoints0.009828
switzerland0.009828
Number of experiments associating the term to the sequence
TermScore
mouse63.000000
mus musculus63.000000
research facility59.000000
feces49.000000
united states of america41.000000
control24.000000
LOWER IN control23.000000
c57bl/621.000000
LOWER IN mouse chow15.000000
mouse chow13.000000
high fat diet13.000000
female13.000000
LOWER IN high fat diet12.000000
c57bl/6j10.000000
diet9.000000
caecum8.000000
balb/c7.000000
male7.000000
jackson laboratories6.000000
antibiotic5.000000
LOWER IN c57bl/64.000000
colon4.000000
LOWER IN feces4.000000
LOWER IN late timepoints4.000000
taconic farms3.000000
LOWER IN jackson laboratories3.000000
LOWER IN antibiotic3.000000
brazil3.000000
charles river laboratories3.000000
LOWER IN fasting3.000000
state of texas3.000000
age3.000000
LOWER IN iron deficient diet3.000000
iron supplemented diet3.000000
LOWER IN iron supplemented diet3.000000
iron deficient diet3.000000
LOWER IN ketogenic diet3.000000
control diet3.000000
ketogenic diet3.000000
early timepoints3.000000
canada2.000000
LOWER IN taconic farms2.000000
LOWER IN ampicillin2.000000
humanized mouse2.000000
israel2.000000
united kingdom2.000000
LOWER IN age 18 weeks2.000000
age 6 weeks2.000000
age 18 weeks2.000000
LOWER IN age 6 weeks2.000000
colonic mucosa2.000000
south korea2.000000
male organism2.000000
fasting2.000000
LOWER IN balb/c2.000000
LOWER IN c57bl/6j2.000000
LOWER IN low fat diet2.000000
low fat diet2.000000
swiss webster2.000000
state of georgia2.000000
female organism2.000000
germany2.000000
sweden2.000000
LOWER IN western diet2.000000
western diet2.000000
jackson laboratory1.000000
ldlr -/-1.000000
state of ohio1.000000
c57bl/6 t1r2-ko1.000000
LOWER IN c57bl/6 t1r2-ko1.000000
age 8 weeks1.000000
right colon1.000000
LOWER IN terminal ileum1.000000
ileum1.000000
terminal ileum1.000000
glucose diet1.000000
LOWER IN glucose diet1.000000
inulin1.000000
ldlr-1.000000
state of washington1.000000
linoleic acid1.000000
adult1.000000
LOWER IN digestive tract1.000000
digestive tract1.000000
nod mouse1.000000
LOWER IN experimental autoimmune encephalomyelitis1.000000
experimental autoimmune encephalomyelitis1.000000
experimental cerebral malaria1.000000
japan1.000000
malaria1.000000
dss induced colitis1.000000
LOWER IN dss induced colitis1.000000
LOWER IN il-1alpha knockout1.000000
il-1alpha knockout1.000000
house mice1.000000
new york city1.000000
city1.000000
queens region1.000000
LOWER IN manhatten region1.000000
manhatten region1.000000
LOWER IN queens region1.000000
manchester1.000000
skh-1 hairless mouse1.000000
LOWER IN age 9 weeks1.000000
state of oregon1.000000
age 9 weeks1.000000
LOWER IN zinc deficiency1.000000
LOWER IN low zinc diet1.000000
zinc deficiency1.000000
low zinc diet1.000000
LOWER IN non-steroidal anti-inflammatory drug1.000000
LOWER IN indomethacin1.000000
indomethacin1.000000
non-steroidal anti-inflammatory drug1.000000
LOWER IN cefoperazone1.000000
cefoperazone1.000000
cba/j mice1.000000
LOWER IN dextran sulfate sodium1.000000
LOWER IN dss1.000000
state of maryland1.000000
LOWER IN every other day fasting1.000000
every other day fasting1.000000
tongue1.000000
c57bl/6ncrl1.000000
finland1.000000
high fat diet + polydextrose1.000000
polydextrose1.000000
LOWER IN high fat diet + polydextrose1.000000
LOWER IN polydextrose1.000000
harlan sprague dawley1.000000
LOWER IN harlan spague dawley1.000000
a/j1.000000
LOWER IN a/j1.000000
LOWER IN age 24 weeks1.000000
age 24 weeks1.000000
bangladesh diet1.000000
LOWER IN bangladesh diet1.000000
LOWER IN db/db mouse1.000000
obese body mass index status1.000000
db/db mouse1.000000
obesity1.000000
LOWER IN ain-93g rodent diet1.000000
quinoa food product1.000000
ain-93g rodent diet1.000000
LOWER IN quinoa food product1.000000
strain 129s1.000000
nih 31m chow1.000000
state of montana1.000000
state of california1.000000
state of florida1.000000
streptomycin1.000000
adult organism1.000000
nzb/w f11.000000
switzerland1.000000
state of iowa1.000000
cf-11.000000
icr/cd-1 mice1.000000
wild1.000000
age 9 months1.000000
cecal content1.000000
australia1.000000
colonized germ free1.000000
seattle1.000000
state of illinois1.000000
janvier labs1.000000
high sugar diet1.000000
c3h/hej1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in humanized mouse feces united states of america research facility )2018-04-29v41 / 1approvedNo
176amnonhigh freq. in skin of hairless mice (dominant mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v41 / 1approvedNo
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v41 / 1approvedNo
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v41 / 1approvedNo
230amnonmouse genome dna (other mouse, mus musculus, dna)2017-11-02v41 / 1approvedNo
230amnondominant mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v41 / 1approvedNo
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v41 / 1approvedNo
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v41 / 1approvedNo
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v41 / 1approvedNo
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 1approvedNo
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v41 / 2approvedNo
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v41 / 2approvedNo
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 2approvedNo
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v41 / 3approvedNo
954amnonhigher in iron deficient diet in mice treated with antibiotics and salmonella ( high in iron deficient diet compared to iron supplemented diet in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse antibiotic streptomycin salmonella infections )2022-12-15v41 / 3approvedNo
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v41 / 3approvedNo
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v41 / 3approvedNo
494amnon high in colonic mucosa compared to colonic lumen in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v41 / 3approvedNo
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v41 / 4approvedNo
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v41 / 4approvedNo
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v41 / 4approvedNo
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v41 / 4approvedNo
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v41 / 4approvedNo
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v41 / 4approvedNo
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v41 / 5approvedNo
954amnon high in salmonella infections compared to control in streptomycin antibiotic mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum 2022-12-15v41 / 5approvedNo
954amnon high in control compared to salmonella infections in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse antibiotic streptomycin 2022-12-15v41 / 5approvedNo
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 6approvedNo
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v41 / 7approvedNo
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v41 / 7approvedNo
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v41 / 7approvedNo
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v41 / 7approvedNo
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v41 / 7approvedNo
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v41 / 7approvedNo
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v41 / 8approvedNo
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v41 / 8approvedNo
230amnoncommon mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v41 / 8approvedNo
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 8approvedNo
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v31 / 9approvedNo
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v41 / 9approvedNo
494amnon high in colonic lumen compared to colonic mucosa in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v41 / 9approvedNo
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v41 / 10approvedNo
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 10approvedNo
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 10approvedNo
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v41 / 11approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v41 / 11approvedNo
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v41 / 11approvedNo
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 11approvedNo
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v41 / 12approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v41 / 12approvedNo
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v41 / 12approvedNo
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v41 / 12approvedNo
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v41 / 12approvedNo
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v41 / 12approvedNo
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v41 / 12approvedNo
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v41 / 12approvedNo
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v41 / 13approvedNo
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v41 / 13approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v41 / 13approvedNo
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v41 / 13approvedNo
710amnondominant mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v41 / 13approvedNo
954amnondominant caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse, antibiotic, streptomycin2022-12-15v41 / 13approvedNo
611amnon high in male compared to female in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v41 / 13approvedNo
108amnon high in colon compared to caecum in state of texas research facility united states of america mus musculus mouse 2017-04-07v41 / 13approvedNo
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v41 / 13approvedNo
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 13approvedNo
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 13approvedNo
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v41 / 14approvedNo
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v41 / 14approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v41 / 14approvedNo
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v41 / 14approvedNo
954amnondominant mouse, mus musculus, research facility, c57bl/6, female organism, state of florida, united states of america, caecum, iron deficient diet2022-12-15v41 / 14approvedNo
962amnondominant mouse, mus musculus, research facility, feces, united states of america, female organism, c57bl/6, state of rhode island2022-12-20v41 / 14approvedNo
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v41 / 14approvedNo
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v41 / 14approvedNo
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v41 / 15approvedNo
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v41 / 15approvedNo
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v41 / 15approvedNo
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 15approvedNo
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v41 / 15approvedNo
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v41 / 15approvedNo
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v41 / 15approvedNo
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 15approvedNo
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v41 / 15approvedNo
954amnonhigher in mice fed iron defience diet ( high in iron deficient diet compared to iron supplemented diet in mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum )2022-12-15v41 / 15approvedNo
954amnondominant iron supplemented diet, caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v41 / 15approvedNo
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v41 / 15approvedNo
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v41 / 15approvedNo
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v41 / 15approvedNo
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 15approvedNo
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v41 / 15approvedNo
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v31 / 16approvedNo
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v41 / 16approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v41 / 16approvedNo
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v41 / 16approvedNo
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v41 / 16approvedNo
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v41 / 16approvedNo
710amnondominant ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v41 / 16approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v41 / 17approvedNo
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v41 / 17approvedNo
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v31 / 17approvedNo
208amnondominant mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v41 / 17approvedNo
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v41 / 17approvedNo
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v41 / 17approvedNo
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v41 / 17approvedNo
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v41 / 17approvedNo
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v41 / 17approvedNo
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v41 / 17approvedNo
611amnondominant caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v41 / 17approvedNo
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v41 / 17approvedNo
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 17approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v41 / 18approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v41 / 18approvedNo
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus colonic mucosa research facility 2022-05-20v31 / 18approvedNo
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v31 / 18approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v41 / 18approvedNo
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v41 / 18approvedNo
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v41 / 18approvedNo
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 18approvedNo
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v31 / 19approvedNo
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v41 / 19approvedNo
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v41 / 19approvedNo
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 19approvedNo
954amnoncommon streptomycin, antibiotic, mouse, mus musculus, research facility, c57bl/6, female organism, state of florida, united states of america, caecum2022-12-15v41 / 19approvedNo
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 19approvedNo
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v41 / 19approvedNo
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v41 / 19approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 19approvedNo
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v41 / 20approvedNo
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v41 / 20approvedNo
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v31 / 20approvedNo
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v41 / 20approvedNo
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v41 / 20approvedNo
954amnonlower in iron deficient diet in mice treated with antibiotics and salmonella ( high in iron supplemented diet compared to iron deficient diet in salmonella infections streptomycin antibiotic mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum )2022-12-15v41 / 20approvedNo
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v41 / 20approvedNo
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v41 / 20approvedNo
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 20approvedNo
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v41 / 21approvedNo
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v41 / 21approvedNo
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v41 / 21approvedNo
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v41 / 21approvedNo
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v41 / 21approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 21approvedNo
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 22approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v41 / 22approvedNo
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v41 / 22approvedNo
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v31 / 22approvedNo
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v41 / 22approvedNo
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v41 / 22approvedNo
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 22approvedNo
611amnon high in ovariectomy ovariectomized female compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v41 / 22approvedNo
611amnon high in control compared to ovariectomy ovariectomized female in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v41 / 22approvedNo
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v31 / 22approvedNo
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 22approvedNo
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 23approvedNo
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v41 / 23approvedNo
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v41 / 23approvedNo
956amnon high in no bean flour diet compared to bean flour diet in 6-propyl-2-thiouracil high fat diet caecum research facility brazil adult organism male organism balb/c mus musculus mouse 2022-12-17v41 / 23approvedNo
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v41 / 23approvedNo
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v41 / 24approvedNo
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v41 / 24approvedNo
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 25approvedNo
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v31 / 25approvedNo
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v31 / 25approvedNo
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v31 / 25approvedNo
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v41 / 25approvedNo
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v31 / 26approvedNo
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v31 / 26approvedNo
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v41 / 26approvedNo
956amnondominant mouse, mus musculus, balb/c, male organism, adult organism, brazil, research facility, caecum, mouse chow2022-12-17v41 / 26approvedNo
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 27approvedNo
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 28approvedNo
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v31 / 29approvedNo
954amnonlower in mice fed iron defience diet ( high in iron atom iron supplemented diet compared to iron deficient diet in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse )2022-12-15v41 / 29approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v41 / 29approvedNo
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v41 / 29approvedNo
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v41 / 30approvedNo
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v41 / 30approvedNo
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 31approvedNo
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 31approvedNo
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v41 / 31approvedNo
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v41 / 31approvedNo
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v31 / 32approvedNo
611amnon high in female compared to male in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v41 / 33approvedNo
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v31 / 33approvedNo
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 34approvedNo
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v31 / 35approvedNo
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v41 / 36approvedNo
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 36approvedNo
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 36approvedNo
956amnon high in high fat diet 6-propyl-2-thiouracil compared to mouse chow in mouse mus musculus balb/c male organism adult organism brazil research facility caecum 2022-12-17v41 / 36approvedNo
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v41 / 37approvedNo
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 37approvedNo
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v41 / 38approvedNo
909amnon high in age 6 weeks compared to age 18 weeks in colonic mucosa manchester united kingdom mouse mus musculus research facility 2022-05-20v31 / 39approvedNo
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v41 / 40approvedNo
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v41 / 40approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 41approvedNo
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v31 / 41approvedNo
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v41 / 42approvedNo
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 44approvedNo
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 44approvedNo
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v41 / 45approvedNo
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v41 / 47approvedNo
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v41 / 47approvedNo
956amnon high in mouse chow compared to 6-propyl-2-thiouracil high fat diet in caecum research facility brazil adult organism male organism balb/c mus musculus mouse 2022-12-17v41 / 48approvedNo
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v41 / 49approvedNo
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 50approvedNo
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 51approvedNo
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 51approvedNo
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v41 / 51approvedNo
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 51approvedNo
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 52approvedNo
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v31 / 53approvedNo
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v41 / 53approvedNo
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v41 / 58approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v41 / 58approvedNo
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v41 / 59approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v41 / 60approvedNo
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 60approvedNo
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 60approvedNo
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 60approvedNo
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 61approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v41 / 62approvedNo
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v41 / 63approvedNo
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 64approvedNo
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v41 / 65approvedNo
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v41 / 66approvedNo
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v41 / 68approvedNo
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v41 / 70approvedNo
386amnon high in ecuador compared to bolivia in mouse mus musculus caecum wild 2018-10-28v41 / 70approvedNo
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v41 / 70approvedNo
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 72approvedNo
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v31 / 72approvedNo
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v41 / 73approvedNo
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 74approvedNo
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 75approvedNo
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v41 / 75approvedNo
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 76approvedNo
954amnoncommon iron deficient diet, caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v41 / 77approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v41 / 78approvedNo
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v41 / 81approvedNo
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v31 / 81approvedNo
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v41 / 83approvedNo
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v41 / 85approvedNo
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 85approvedNo
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v41 / 85approvedNo
108amnon high in caecum compared to colon in state of texas research facility united states of america mus musculus mouse 2017-04-07v41 / 86approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v41 / 89approvedNo
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v41 / 89approvedNo
962amnoncommon state of rhode island, c57bl/6, female organism, united states of america, feces, research facility, mus musculus, mouse2022-12-20v41 / 90approvedNo
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v41 / 90approvedNo
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v41 / 91approvedNo
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v41 / 92approvedNo
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v41 / 94approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v41 / 95approvedNo
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v41 / 97approvedNo
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v41 / 99approvedNo
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 99approvedNo
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v41 / 100approvedNo
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v41 / 101approvedNo
956amnoncommon mouse chow, caecum, research facility, brazil, adult organism, male organism, balb/c, mus musculus, mouse2022-12-17v41 / 103approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v41 / 104approvedNo
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v41 / 106approvedNo
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v41 / 107approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v41 / 108approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v41 / 108approvedNo
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v41 / 109approvedNo
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v41 / 110approvedNo
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v41 / 113approvedNo
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v41 / 113approvedNo
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v41 / 113approvedNo
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v41 / 116approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 119approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v41 / 120approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v41 / 120approvedNo
954amnoncommon iron supplemented diet, , caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v41 / 120approvedNo
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v41 / 120approvedNo
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v41 / 120approvedNo
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v41 / 121approvedNo
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v41 / 122approvedNo
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v41 / 122approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 126approvedNo
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 127approvedNo
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v41 / 129approvedNo
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v41 / 129approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v41 / 130approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 130approvedNo
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in mus musculus mouse feces united states of america )2017-04-14v41 / 131approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v41 / 132approvedNo
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v41 / 132approvedNo
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v41 / 133approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v41 / 135approvedNo
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v31 / 135approvedNo
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 136approvedNo
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v31 / 137approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v41 / 137approvedNo
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v41 / 139approvedNo
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 140approvedNo
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v41 / 141approvedNo
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v41 / 143approvedNo
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v41 / 145approvedNo
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v41 / 145approvedNo
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 147approvedNo
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v41 / 148approvedNo
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v41 / 148approvedNo
710amnoncommon mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v41 / 151approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v41 / 151approvedNo
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 152approvedNo
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v41 / 153approvedNo
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v41 / 154approvedNo
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v41 / 154approvedNo
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v41 / 154approvedNo
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v41 / 155approvedNo
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v41 / 158approvedNo
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v31 / 161approvedNo
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v31 / 161approvedNo
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v41 / 161approvedNo
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v41 / 161approvedNo
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v41 / 162approvedNo
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 163approvedNo
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v41 / 165approvedNo
956amnon high in bean flour diet compared to no bean flour diet in mouse mus musculus balb/c male organism adult organism brazil research facility caecum high fat diet 6-propyl-2-thiouracil 2022-12-17v41 / 166approvedNo
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v41 / 167approvedNo
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v31 / 168approvedNo
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v31 / 168approvedNo
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v41 / 168approvedNo
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v31 / 170approvedNo
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 170approvedNo
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v41 / 172approvedNo
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v41 / 172approvedNo
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v41 / 177approvedNo
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v41 / 180approvedNo
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v41 / 181approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v41 / 182approvedNo
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v41 / 183approvedNo
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v41 / 183approvedNo
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v41 / 184approvedNo
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v41 / 185approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v41 / 186approvedNo
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v41 / 186approvedNo
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v31 / 188approvedNo
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v41 / 189approvedNo
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v41 / 189approvedNo
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v41 / 190approvedNo
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 193approvedNo
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 193approvedNo
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v41 / 196approvedNo
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v41 / 199approvedNo
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v41 / 200approvedNo
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 203approvedNo
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v41 / 203approvedNo
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v41 / 204approvedNo
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v41 / 207approvedNo
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 209approvedNo
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v41 / 210approvedNo
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 224approvedNo
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v41 / 224approvedNo
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 225approvedNo
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v41 / 232approvedNo
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v41 / 232approvedNo
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 237approvedNo
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v41 / 238approvedNo
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v41 / 239approvedNo
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v41 / 241approvedNo
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v41 / 241approvedNo
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v41 / 246approvedNo
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v41 / 250approvedNo
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 255approvedNo
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v41 / 255approvedNo
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in mouse mus musculus caecum wild south america )2018-10-28v41 / 255approvedNo
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v41 / 257approvedNo
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v41 / 257approvedNo
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v41 / 260approvedNo
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v41 / 262approvedNo
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 263approvedNo
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v41 / 265approvedNo
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 267approvedNo
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 275approvedNo
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v41 / 275approvedNo
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v41 / 281approvedNo
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v41 / 284approvedNo
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v41 / 293approvedNo
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v41 / 295approvedNo
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v41 / 297approvedNo
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 299approvedNo
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 306approvedNo
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v41 / 316approvedNo
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v41 / 325approvedNo
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v31 / 325approvedNo
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v41 / 328approvedNo
710amnon high in feces compared to small intestine stomach in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v41 / 329approvedNo
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v41 / 338approvedNo
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v41 / 339approvedNo
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v41 / 343approvedNo
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v41 / 362approvedNo
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v41 / 370approvedNo
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 379approvedNo
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 380approvedNo
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v41 / 385approvedNo
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 394approvedNo
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v41 / 495approvedNo
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v41 / 579approvedNo
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 644approvedNo

Problems / suggestions? Please email info AT dbbact DOT org