Summary for ontology term: msm

Number of annotations with term: 31

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.107143
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.107143
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTCATGCAAGCAGGATGTGAAACCCCCGGGCTTAACCTGGGAACTGCATTCTGAACTACATGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.107143
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTCGTAGGCCGGGAGTCAAATCCGGGGGCTCAACCCCCGCCCGCTCCCGGAACCCCGAGGCTTGAGTCTGGCAGGGGAGGGTGGAATTCCCAGT0.107143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTTTGTTAAGTCGGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.107143
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGCTGGGCAAGTTGGTAGTGAAATTCCGGGGCTTAACTCCGGCGCTACTACCAAGACTGTTCAGCTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.107143
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGCAGGCGGCGCGCCAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGAACTGGCGCGCTCGGGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.107143
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGGCAGGCCGGGGGTCAAATGCGGGGGCTCAACCCCCGCCCGCCCCCGGAACCTCCGGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGGT0.107143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGAGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTGGAAACTGTTTTTCTGGAGTACTGGAAGGGCAGGCGGAATTCCTGG0.107143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTTTTAAGCGTGTTGTGAAATACTGTCGCTCAACGACAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAATGTAGGCGGAATTCGTCG0.107143

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__BarnesiellaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCACGCCAAGTCAGCGGTGAAATTTTCGGGCTCAACCCGGACTGTGCCGTTGAAACTGGCGAGCTAGAGTGCACAAGAGGCAGGCGGAATGCGTGG0.600000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGCTTAATAAGTCGAGCGTGAAAATGCGGGGCTCAACCCCGTATGGCGCTGGAAACTGTTAGGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTCATCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAATCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGCAGGCGGAATTCCCGGT0.600000
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGAAGACGGCCCTATGGGTTGTAAACTGCTTTTATAGGGGGATAAAGTGTGCCACGTGTGGCATATTGCAGGTACCCTATGAATAAGGACCGGCTAATT0.277778
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTCC0.242424
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTCC0.242424
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGAATGGTCTATGGCCTGTAAACCTCTTTTGTCAAGGAAGAACATGTAGTACGTGTACTACCCTGCCAGTACTTGACGAATAAGCATCGGCTAACT0.235294
d__BacteriaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGGAGTCAAGTCAGTTGTGAAAAGCCACGGCCCAACCGTGGTCGTGCAGTTGAAACTGGTTCTCTTGAGTGCGCACGAGGACGGTGGAATTCGTGG0.228571
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTGGGGAATTTTGGACAATGGGGGAAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGACGAAAAGTCGTATTTAAATAAAGTACGATGCTGACGGTACCTGAAGAATAAGCACCGGC0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTGAGGAATATTGGTCAATGGCCGAGAGGCTGAACCAGCCAAGTCGCGTGAAGGAAGAAGGATCTATGGTTTGTAAACTTCTTTTATAGGGGAATAAAGTGAGGGACGTGTCCCTTTTTGTATGTACCCTATGAATAAGCATCGGCTAACT0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGAATGGTCTATGGCCTGTAAACCTCTTTTGTCAAGGAAGAATAAGCGGCACGAGTGCCACCTTGCCAGTACTTGACGAATAAGCATCGGCTAACT0.222222
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTAGGGAATTTTCGGCAATGGGGGAAACCCTGACCGAGCAACGCCGCGTGAGCGAAGAAGGCCTTCGGGTCGTAAAGCTCTGTTGTAAAGGAAGAACGTCGGACACAGGAAATGGTGTGCGAGTGACGGTACTTTACCAGAAAGCCACGGC0.216216
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTGGGGAATTTTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGACGAAAAGGGACGGGTTAAGAGCTAGTTCCGCTGACGGTACCTGAAGAATAAGCACCGGC0.210526

Annotations:

common ontology terms
term enrichment score
TermScore
homosexual0.851735
msm0.851735
gay0.633540
hiv infection0.325123
denver0.279070
state of colorado0.263158
heterosexual0.222222
msw0.222222
LOWER IN heterosexual0.222222
LOWER IN msw0.222222
LOWER IN homosexual0.216216
LOWER IN msm0.216216
rectal swab0.196721
amsterdam0.196078
LOWER IN hiv infection0.195122
LOWER IN gay0.171429
kingdom of the netherlands0.163934
male0.157205
sweden0.108434
kingdom of spain0.081818
city0.072072
LOWER IN acquired immunodeficiency syndrome0.060606
LOWER IN sweden0.043478
control0.039900
LOWER IN kingdom of spain0.038462
homo sapiens0.036232
adult0.033728
feces0.031348
LOWER IN control0.027778
united states of america0.023733
Fraction of dbbact annotations with this term covered by the query
TermScore
homosexual0.833333
msm0.833333
heterosexual0.800000
msw0.800000
LOWER IN heterosexual0.800000
LOWER IN msw0.800000
LOWER IN gay0.750000
gay0.750000
LOWER IN homosexual0.666667
LOWER IN msm0.666667
denver0.500000
LOWER IN acquired immunodeficiency syndrome0.500000
LOWER IN hiv infection0.400000
hiv infection0.300000
amsterdam0.250000
state of colorado0.222222
rectal swab0.200000
kingdom of the netherlands0.166667
male0.090909
sweden0.066667
LOWER IN sweden0.066667
city0.050000
kingdom of spain0.047619
LOWER IN kingdom of spain0.047619
control0.021622
homo sapiens0.018450
adult0.017341
LOWER IN control0.016216
feces0.015924
united states of america0.012146
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
homosexual0.870968
msm0.870968
adult0.612903
male0.580645
gay0.548387
united states of america0.516129
hiv infection0.354839
state of colorado0.322581
kingdom of spain0.290323
sweden0.290323
control0.258065
denver0.193548
rectal swab0.193548
kingdom of the netherlands0.161290
amsterdam0.161290
heterosexual0.129032
msw0.129032
LOWER IN homosexual0.129032
LOWER IN msm0.129032
LOWER IN hiv infection0.129032
LOWER IN heterosexual0.129032
LOWER IN msw0.129032
city0.129032
LOWER IN gay0.096774
LOWER IN control0.096774
LOWER IN sweden0.032258
LOWER IN kingdom of spain0.032258
LOWER IN acquired immunodeficiency syndrome0.032258
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 1
344amnon high in control compared to hiv infection in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 2
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam homosexual msm 2020-05-31v4No1 / 9
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 18
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
563amnondominant feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 32
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v4No1 / 100
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
629amnon high in homosexual msm compared to heterosexual msw in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 154
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519

Problems / suggestions? Please email info AT dbbact DOT org