Summary for ontology term: multi-tissue plant structure

Number of annotations with term: 236

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.034483
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.030172
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.030172
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.030172
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Kineosporiaceae;g__KineococcusTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTGTGTCGCGTCTGCTGTGAAAACTCAGGGCTCAACTCTGAGCTTGCAGTGGGTACGGGCACACTAGAGTGCTGTAGGGGAGACTGGAATTCCTGG0.030172
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTAAGTTAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.030172
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.025862
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTAAGAGGTGAAAGCCCAGAGCTCAACTCTGGAATTGCCTTTTAGACTGCATCGCTTGAATCATGGAGAGGTCAGTGGAATTCCGAG0.025862
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTCAGGGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAGACTGCATCGCTTGAATCCGGGAGAGGTAAGTGGAATTCCGAG0.025862
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.025862

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGGGCTCAACTCCGGAATTGCCTTTAAGACTGCATCGCTAGAATTGTGGAGAGGTAAGTGGAATTCCGAG0.400000
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGCCAGATGTGAAATCCCCGGGCTTAACCTGGGAATGGCATTTGGGACTGCAAGGCTTGAGTGCGGCAGAGGAGACTGGAATTCCTGG0.360000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.360000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Solirubrobacteraceae;g__SolirubrobacterTACGTAGGGGGCTAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGTCCGGTAAGTCCGCTGTGAAAGTCGGGGGCTCAACCCTCGGATGCCGGTGGATACTGTCGGGCTTGAGTACGGAAGAGGCGAGTGGAATTCCTGG0.360000
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCGCGTTAAGACAGGTGTGAAAGCCCCGAGCTTAACTTGGGAATTGCGCTTGTGACTGGCGTGCTGGAGTGTGGCAGAGGGAGGTGGAATTCCACG0.320000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__RamlibacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTGATGTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATCGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.320000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.320000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTTCTAAGTCGAACGTGAAATCCCCGGGCTCAACCCGGGAACTGCGTCCGATACTGGAAGGCTTGAATCCGGGAGAGGGATGCGGAATTCCAGG0.320000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGCCAACTAAGTCAGACGTGAAATCCCTCGGCTTAACCGGGGAACTGCGTCTGATACTGGATGGCTTGAGTTTGGGAGAGGGACGCGGAATTCCAGG0.320000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__FlavisolibacterTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGAGGGCAGGTAAGTCAGTGGTGAAATCTCCAAGCTTAACTTGGAAACTGCCGTTGATACTATCTGTCTTGAATACCGTGGAGGTGAGCGGAATATGTCA0.320000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.309783
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCGTTTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATGGCCTTCGATACTGGGACGCTTGAGTATGGTAGAGGTTGGTGGAACTGCGAG0.241758
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGATCTTAAGTCAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTTGATACTGGGGTCCTTGAGTCCGGAAGAGGTGAGTGGAACTGCGAG0.234899
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGCTTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.228155
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTCTTTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATTGCCTTCGATACTGGGAGACTTGAGTTCGGAAGAGGTTGGTGGAACTGCGAG0.209524
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTAAGAGGTGAAAGCCCAGAGCTCAACTCTGGAATTGCCTTTTAGACTGCATCGCTTGAATCATGGAGAGGTCAGTGGAATTCCGAG0.208426
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCATTCAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATTGCCTTCGATACTGTTTGGCTTGAGTTTGGTAGAGGTTGGTGGAACTGCGAG0.207595
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Pseudonocardiaceae;g__ActinomycetosporaTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTGTGTCGCGTCGGCCGTGAAAACCTGGGGCTCAACTCTGGGCGTGCGGTCGATACGGGCATCACTTGAGTTCGGCAGGGGAGACTGGAATTCCTG0.205962
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGAATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTAGGGCAGAGGGTGGTGGAATTTCCTG0.199461
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__TerriglobusTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTTTGGCAAGTTTCGTGTGAAATCTTCGGGCTCAACTCGAAGTCTGCACGGAAAACTGCCGGGCTTGAGTATGGGAGAGGTGAGTGGAATTTCCGG0.189474

Annotations:

common ontology terms
term enrichment score
TermScore
leaf0.677226
root0.425333
stem0.221402
greenhouse0.217143
citrus0.188006
austria0.154696
plant0.146882
agave0.144928
cultivated environment0.144578
minas gerais state0.132353
campos rupestres0.132353
populus0.132353
root endosphere0.131443
leaf surface0.125000
state of california0.123533
tree0.123167
brazil0.118519
mexico0.113565
state of tennessee0.110429
endosphere0.109948
campinas0.106061
guanajuato0.106061
rhizosphere0.105340
leaf endosphere0.102632
state of florida0.101382
desert0.101010
saccharum0.100719
sugarcane0.100719
zostera marina0.094488
LOWER IN root0.094488
vitis vinifera0.087129
marine eelgrass0.079681
vellozia epidendroides0.078125
boechera stricta0.078125
cannabis sativa0.078125
hedera hibernica0.078125
ivy0.078125
state of idaho0.075188
ocean0.072289
bodega bay0.063492
citrus unshiu0.063492
barbacenia macrantha0.063492
merlot0.063492
grapevine0.063492
belgium0.063291
brassicaceae0.061350
canada0.060325
orchard0.059701
state of north carolina0.056338
maryland county0.056000
LOWER IN leaf0.053743
LOWER IN rhizosphere0.049470
brassica oleracea0.048980
seed0.048980
exosphere0.048387
agave deserti0.048387
agave salmiana0.048387
agave tequiliana0.048387
zhejiang province0.048193
state of new york0.047059
rice0.046154
forest ecosystem0.045627
oryza sativa0.043165
united states of america0.042000
china0.041905
populus trichocarpa x deltoides0.040650
populus deltoides0.040650
soil0.033919
farm0.033003
alpine bog0.032787
plant surface0.032787
dracaena fragrans0.032787
upper stem0.032787
vero beach, fl0.032787
quincy, fl0.032787
immokalee, fl0.032787
gainesville, fl0.032787
grassland0.032787
moor0.032787
myrtillocactus geometrizans0.032787
opuntia robusta0.032787
french republic0.032680
sphagnum bog0.032258
cactus0.032258
semi-arid0.032258
hawaii0.031250
wheat0.031250
peatland0.030769
solanum lycopersicum0.030303
triticum aestivum0.028571
stem endosphere0.024948
seedling0.024793
stem surface0.024793
ft. pierce, fl0.024793
LOWER IN populus trichocarpa x deltoides0.024793
LOWER IN populus deltoides0.024793
scrubland0.024793
whole plant0.024490
province of quebec0.024490
soybean0.024490
Fraction of dbbact annotations with this term covered by the query
TermScore
leaf0.952381
root0.933333
stem0.857143
leaf surface0.800000
endosphere0.750000
leaf endosphere0.750000
root endosphere0.750000
marine eelgrass0.666667
zostera marina0.666667
LOWER IN root0.666667
brassica oleracea0.666667
seed0.666667
stem endosphere0.666667
vitis vinifera0.666667
alpine bog0.500000
plant surface0.500000
sphagnum0.500000
nephrolepis cordifolia0.500000
dracaena marginata0.500000
dracaena fragrans0.500000
epipremnum aureum0.500000
howea forsteriana0.500000
musa acuminate0.500000
rhizome0.500000
eelgrass0.500000
bodega bay0.500000
musa paradisiaca0.500000
malvaviscus penduliflorus0.500000
achatinella mustelina0.500000
LOWER IN achatinella mustelina0.500000
seedling0.500000
fruit0.500000
neve yaar0.500000
citrus unshiu0.500000
LOWER IN diaporthe citri0.500000
diaporthe citri0.500000
maryland county0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
alouatta pigra0.500000
howler monkey0.500000
barbacenia macrantha0.500000
LOWER IN soilwater0.500000
tsuga canadensis0.500000
eastern hemlock0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
tsuga sieboldii0.500000
southern japanese hemlock0.500000
tsuga chinensis0.500000
chinese hemlock0.500000
phyllosphere0.500000
campinas0.500000
boechera stricta0.500000
exosphere0.500000
stem surface0.500000
upper stem0.500000
vero beach, fl0.500000
quincy, fl0.500000
immokalee, fl0.500000
ft. pierce, fl0.500000
gainesville, fl0.500000
pierce, fl0.500000
huanglongbing0.500000
propagation stage0.500000
cannabis sativa0.500000
pre-vegetative stage0.500000
early flowering stage0.500000
late flowering stage0.500000
merlot0.500000
grapevine0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
populus0.500000
seed structure0.500000
grassland0.500000
kobresia humilis0.500000
steppe0.500000
LOWER IN stem surface0.500000
LOWER IN upper stem0.500000
populus trichocarpa x deltoides0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
hedera hibernica0.500000
ivy0.500000
scrubland0.500000
moor0.500000
LOWER IN scrubland0.500000
LOWER IN moor0.500000
aloe arborescens0.500000
aloe0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
Fraction of annotations for the query sequences containing the term
TermScore
leaf0.525424
root0.275424
united states of america0.224576
plant0.207627
greenhouse0.161017
brazil0.135593
stem0.127119
citrus0.122881
austria0.118644
state of california0.105932
cultivated environment0.101695
china0.093220
state of florida0.093220
tree0.088983
agave0.084746
desert0.084746
minas gerais state0.076271
campos rupestres0.076271
rhizosphere0.076271
state of tennessee0.076271
populus0.076271
mexico0.076271
root endosphere0.072034
leaf surface0.067797
endosphere0.059322
saccharum0.059322
sugarcane0.059322
campinas0.059322
guanajuato0.059322
leaf endosphere0.055085
canada0.055085
zostera marina0.050847
ocean0.050847
LOWER IN root0.050847
vitis vinifera0.046610
marine eelgrass0.042373
vellozia epidendroides0.042373
brassicaceae0.042373
boechera stricta0.042373
state of idaho0.042373
farm0.042373
cannabis sativa0.042373
hedera hibernica0.042373
belgium0.042373
ivy0.042373
bodega bay0.033898
orchard0.033898
zhejiang province0.033898
citrus unshiu0.033898
barbacenia macrantha0.033898
state of north carolina0.033898
state of new york0.033898
merlot0.033898
grapevine0.033898
LOWER IN leaf0.029661
soil0.029661
maryland county0.029661
LOWER IN rhizosphere0.029661
forest ecosystem0.025424
brassica oleracea0.025424
seed0.025424
LOWER IN control0.025424
oryza sativa0.025424
rice0.025424
exosphere0.025424
agave deserti0.025424
agave salmiana0.025424
agave tequiliana0.025424
french republic0.021186
populus trichocarpa x deltoides0.021186
populus deltoides0.021186
peatland0.016949
alpine bog0.016949
plant surface0.016949
sphagnum bog0.016949
dracaena fragrans0.016949
hawaii0.016949
triticum aestivum0.016949
wheat0.016949
control0.016949
solanum lycopersicum0.016949
upper stem0.016949
vero beach, fl0.016949
quincy, fl0.016949
immokalee, fl0.016949
gainesville, fl0.016949
grassland0.016949
moor0.016949
myrtillocactus geometrizans0.016949
opuntia robusta0.016949
cactus0.016949
semi-arid0.016949
whole plant0.012712
seedling0.012712
brassica0.012712
stem endosphere0.012712
province of quebec0.012712
LOWER IN soil0.012712
stem surface0.012712
ft. pierce, fl0.012712
Exp. ID User ID Description Date Region Flag Sequences
361amnondominant leaf, austria, greenhouse, plant, nephrolepis cordifolia2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 1
156amnonchloroplast (brassica) (other brassica, leaf, china)2017-07-02v4No1 / 1
37amnonhigh in tomato plant leaves compared to plastic control ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v4No1 / 1
98amnonHuanglongbing (Citrus greening) disease (other citrus, pathogen, leaf, huanglongbing, disease, state of florida)2017-04-01v4No1 / 1
101amnondominant state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 1
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
171amnondominant united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 2
98amnondominant citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 2
101amnondominant state of new york, merlot, vitis vinifera, grapevine, united states of america, leaf2017-04-03v4No1 / 2
894amnon high in diaporthe citri plant disease compared to control in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 3
80amnonHigher in leaf season compared to fruit season ( high in season leaf compared to botanical fruit food product in feces central america alouatta pigra howler monkey state of florida )2017-03-03v4No1 / 3
98amnondominant citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 3
98amnondominant citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 3
192amnondominant seed, seed structure, brassica napus2017-09-05v4No1 / 3
462amnondominant united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 3
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 4
98amnondominant citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 4
98amnondominant citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 4
894amnon high in control compared to diaporthe citri plant disease in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
189amnondominant united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 6
156amnondominant brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 6
266amnonhigh freq. in roots in SIL garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 6
615amnondominant endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 6
279amnondominant grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 6
360amnondominant agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 6
28amnonhigh freq. in leaves in hawaii (dominant hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 7
98amnondominant citrus, rhizosphere, pierce, fl, state of florida, root2017-04-01v4No1 / 7
130amnondominant peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 7
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 8
29amnondominant brassica oleracea, french republic, seed2016-12-05v4No1 / 8
37amnonhigh in tomato plant leaves compared to plastic controls ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v4No1 / 8
98amnondominant citrus, rhizosphere, quincy, fl, state of florida, root2017-04-01v4No1 / 8
894amnon high in control compared to plant disease diaporthe citri in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 9
98amnondominant citrus, rhizosphere, immokalee, fl, state of florida, root2017-04-01v4No1 / 9
98amnondominant citrus, rhizosphere, gainesville, fl, state of florida, root2017-04-01v4No1 / 9
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, leaf2017-04-03v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 9
360amnondominant agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 10
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
235amnonhigh freq. in eelgrass roots (dominant ocean, rhizome, zostera marina, marine eelgrass, root)2017-11-07v4No1 / 12
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
266amnonhigh freq. in roots in MAH garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
279amnondominant grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 12
462amnondominant united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 12
894amnondominant citrus unshiu, china, endosphere, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 13
98amnondominant citrus, rhizosphere, vero beach, fl, state of florida, root2017-04-01v4No1 / 13
618amnondominant pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 13
615amnondominant leaf endosphere, leaf, endosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 13
360amnondominant agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 13
360amnondominant agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 13
130amnon high in vaccinium compared to sphagnum in peatland leaf austria plant alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 13
361amnoncommon leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
235amnonhigh freq. in eelgrass leaf (dominant ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 14
360amnondominant agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 14
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
29amnon high in seedling compared to seed in brassica oleracea french republic 2016-12-05v4No1 / 15
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 15
432amnondominant united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
618amnondominant late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 15
462amnondominant united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 15
360amnondominant agave salmiana, agave, leaf, leaf endosphere, desert, guanajuato, mexico2018-08-21v4No1 / 15
548amnonhigh freq. in leaf surface of barbacenia macrantha (dominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 16
360amnondominant agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 16
128amnondominant hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 16
37amnondominant maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 17
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 17
432amnondominant united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
266amnonhigh freq. on perennial plant leaves (dominant brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 17
360amnondominant agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
361amnoncommon leaf, austria, greenhouse, plant, nephrolepis cordifolia2018-08-21v4No1 / 18
235amnoncommon in eelgrass leaf (common ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 18
894amnondominant citrus unshiu, china, leaf surface, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 18
548amnonhigh freq. on leaf surface (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 18
615amnondominant stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 18
128amnondominant hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 18
662amnondominant in cucumber surface (dominant fruit, surface, cucumber, cucumis sativus, neve yaar, israel)2020-09-22v3No1 / 19
37amnonhigh freq. in plastic leaf plants (in field next to tomato plants) (dominant maryland county, leaf)2016-12-09v4No1 / 19
615amnondominant exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 19
271amnoncommon depth (soil) 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 21
618amnondominant canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 21
265amnonhigh freq. in tree leaves (dominant canada, province of quebec, tree, leaf)2017-12-11v4No1 / 22
432amnondominant united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnondominant united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
128amnondominant hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 23
618amnondominant early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 24
29amnoncommon in various plant seeds ( high in compared to in french republic seed )2016-12-05v4No1 / 26
462amnoncommon united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 28
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
360amnondominant agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
101amnoncommon state of new york, united states of america, leaf, vitis vinifera, merlot, grapevine2017-04-03v4No1 / 32
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v4No1 / 33
361amnoncommon leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 34
361amnoncommon leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 37
360amnoncommon agave salmiana, agave, leaf, leaf endosphere, desert, guanajuato, mexico2018-08-21v4No1 / 39
28amnoncommon in various trees in hawaii (common hawaii, organic material, forest biome, whole plant, leaf, forest ecosystem)2016-12-05v4No1 / 41
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
618amnoncommon canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 44
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
360amnoncommon agave, agave deserti, leaf, leaf endosphere, desert, state of california2018-08-20v4No1 / 48
662amnoncommon in cucumber surface (common fruit, israel, neve yaar, cucumis sativus, cucumber, surface)2020-09-22v3No1 / 49
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
360amnoncommon agave, leaf, leaf endosphere, desert, guanajuato, mexico, agave tequiliana, cultivated environment2018-08-21v4No1 / 78
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 114
98amnoncommon citrus, leaf, vero beach, fl, state of florida2017-04-01v4No1 / 115
235amnoncommon in eelgrass roots (common marine eelgrass, zostera marina, ocean, rhizome, root)2017-11-07v4No1 / 116
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
615amnon high in leaf endosphere leaf compared to upper stem stem endosphere stem in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 118
615amnoncommon leaf endosphere, leaf, endosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 122
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
128amnonhigher in ivy leaves from forest compared to moor ( high in forest ecosystem compared to scrubland moor in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 123
98amnoncommon citrus, leaf, ft. pierce, fl, state of florida2017-04-01v4No1 / 126
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
29amnoncommon brassica oleracea, french republic, seed2016-12-05v4No1 / 146
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
98amnoncommon citrus, leaf, immokalee, fl, state of florida2017-04-01v4No1 / 160
192amnoncommon seed, seed structure, brassica napus2017-09-05v4No1 / 161
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 164
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
894amnoncommon leaf surface, citrus unshiu, china, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 172
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
98amnoncommon citrus, leaf, quincy, fl, state of florida2017-04-01v4No1 / 188
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
360amnoncommon agave, desert, leaf, leaf surface, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 210
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
98amnoncommon citrus, leaf, gainesville, fl, state of florida2017-04-01v4No1 / 215
130amnon high in sphagnum compared to vaccinium in peatland leaf plant austria alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 222
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 254
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
236amnon high in leaf compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 287
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 287
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 288
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v4No1 / 298
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
29amnon high in seed compared to seedling in brassica oleracea french republic 2016-12-05v4No1 / 379
28amnon high in feces achatinella mustelina compared to whole plant leaf in hawaii 2016-12-05v4No1 / 413
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
28amnon high in whole plant leaf compared to feces achatinella mustelina in hawaii 2016-12-05v4No1 / 471
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
360amnoncommon agave, desert, leaf, leaf surface, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 492
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 505
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 525
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon agave, desert, state of california, agave deserti, leaf, leaf surface2018-08-21v4No1 / 649
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 819
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v4No1 / 950
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org