Summary for ontology term: mus musculus

Number of annotations with term: 433

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCCGGGCTTAACCCGGGAACTGCTTTGGAAACTGTACGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.013393
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.011161
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.011161
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGCCGGGCAAGTCCGCAGTAAAAACTGGAGGCTCAACCTTCAGGGGCTGCGGAAACTGTCCGGCTGGAGAGCAGGAGAGGACGGTGGAACTCCATGT0.011161
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTTACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTAGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.011161
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.011161
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.011161
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTACTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.011161

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTGGCAAGCCAGATGTGAAAGGCTGGGGCTCAACCCCAGGACTGCATTTGGAACTGTCATGCTAGAGTGTCGGAGAGGCAGGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCGCAGGCTCAACCTGCGAACTGCATTTGAAACTGTTTCCCTTGAGTATCGGAGAGGTCATCGGAATTCCTAG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAATGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGGAGTGAAAGGCAGGGGCCCAACCCCTGGACTGCTCTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATTCCGGGGCTCAACCCCGGACCTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCTGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGAGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.200000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.498489
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCACGGGCTCAACCCGTGAACTGCATTTGAAACTGTTTCCCTTGAGTGTCGGAGAGGTAATCGGAATTCCTTG0.432886
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.403279
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.399334
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCGGCTAGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.393617
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTTGACAAGTCAGATGTGAAATCCTGCGGCTTAACCGCAGAACTGCATTTGAAACTGTTGATCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.391823
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.382514
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCGGCAAGTCTGAAGTGAAAGGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTGCCATGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.375439
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGCGAGAAAGTTGAATGTTAAATCTACCGGCTTAACTGGTAGCTGCGTTCAAAACTTCTTGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.372760
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGACGTGAAATTCCAGGGCTCAACCCTGGAACTGCGTTTGAAACTGTTCTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.370497

Annotations:

common ontology terms
term enrichment score
TermScore
mus musculus1.021898
mouse0.981648
research facility0.539214
c57bl/60.521544
united states of america0.257890
feces0.255822
c57bl/6j0.215754
high fat diet0.181937
caecum0.171445
mouse chow0.170724
female0.170380
balb/c0.153518
jackson laboratories0.147731
control0.116992
male0.116261
LOWER IN control0.101940
age 8 weeks0.096834
diet0.095299
colon0.085052
charles river laboratories0.078775
canada0.072110
taconic farms0.070433
japan0.070284
LOWER IN mouse chow0.066805
swiss webster0.061674
antibiotic0.061602
manchester0.060738
state of texas0.059532
united kingdom0.059435
age 18 weeks0.057459
state of georgia0.057260
LOWER IN high fat diet0.053933
brazil0.053674
south korea0.052731
female organism0.052731
male organism0.048682
right colon0.047774
sweden0.045369
janvier labs0.044150
ileum0.040568
ketogenic diet0.040179
age 6 weeks0.039130
germany0.038400
state of florida0.036980
obesity0.036623
iron supplemented diet0.036281
iron deficient diet0.036281
age 9 months0.035635
terminal ileum0.034409
LOWER IN antibiotic0.033264
state of oregon0.033264
cecal content0.032720
state of illinois0.032193
low fat diet0.031567
jackson laboratory0.031320
ldlr -/-0.031320
ldlr-0.031320
colonic mucosa0.031320
strain 129s0.031320
c3h/hej0.031320
gastrointestinal system0.030601
state of washington0.029915
control diet0.029915
wild0.028860
israel0.028426
stress0.027211
c57bc/6ncrl0.026966
state of maryland0.026966
c57bl/6ncrl0.026966
streptomycin0.026966
nzb/w f10.026966
colonized germ free0.026966
seattle0.026966
high sugar diet0.026966
LOWER IN colon0.026053
state of ohio0.025918
LOWER IN c57bl/60.025918
finland0.025263
state of california0.024653
LOWER IN caecum0.024194
adult organism0.023211
db/db mouse0.022573
LOWER IN jackson laboratories0.022489
LOWER IN late timepoints0.022447
age 9 weeks0.022321
fasting0.022321
obese body mass index status0.022075
australia0.020168
LOWER IN feces0.018937
LOWER IN iron deficient diet0.018307
LOWER IN iron supplemented diet0.018307
western diet0.018223
LOWER IN taconic farms0.018141
nod mouse0.018141
house mice0.018141
LOWER IN fasting0.018141
cf-10.018141
icr/cd-1 mice0.018141
state of montana0.017978
early timepoints0.017978
Fraction of dbbact annotations with this term covered by the query
TermScore
c57bl/61.100000
high fat diet1.083333
mus musculus1.044776
mouse1.032787
balb/c1.000000
LOWER IN high fat diet1.000000
LOWER IN iron deficient diet1.000000
iron supplemented diet1.000000
LOWER IN iron supplemented diet1.000000
iron deficient diet1.000000
salmonella infections1.000000
LOWER IN salmonella infections1.000000
LOWER IN 6-propyl-2-thiouracil1.000000
6-propyl-2-thiouracil1.000000
LOWER IN bean flour diet1.000000
no bean flour diet1.000000
LOWER IN no bean flour diet1.000000
bean flour diet1.000000
LOWER IN mouse chow0.933333
c57bl/6j0.909091
mouse chow0.866667
jackson laboratories0.857143
taconic farms0.750000
stress0.750000
LOWER IN stress0.750000
charles river laboratories0.750000
LOWER IN age 18 weeks0.666667
age 18 weeks0.666667
LOWER IN low fat diet0.666667
low fat diet0.666667
swiss webster0.666667
LOWER IN western diet0.666667
western diet0.666667
LOWER IN normal diet0.600000
normal diet0.600000
LOWER IN ketogenic diet0.600000
ketogenic diet0.600000
jackson laboratory0.500000
ldlr -/-0.500000
c57bl/6 t1r2-ko0.500000
mouse strain o1290.500000
LOWER IN c57bl/6 t1r2-ko0.500000
LOWER IN transverse colon0.500000
transverse colon0.500000
LOWER IN taconic farms0.500000
whole grain diet0.500000
LOWER IN whole wheat diet0.500000
glucose diet0.500000
LOWER IN glucose diet0.500000
tcr-alpha knockout0.500000
c57bc/6ncrl0.500000
immunization heat killed mycobacterium vaccae0.500000
LOWER IN vehicle bbs0.500000
immunized with vehicle bbs0.500000
LOWER IN immunized heat killed mycobacterium vaccae0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
no stress: single housed control0.500000
LOWER IN stress: chronic subordinate colony housing0.500000
no immunization: vehicle as control0.500000
ldlr-0.500000
linoleic acid0.500000
LOWER IN digestive tract0.500000
digestive tract0.500000
nod mouse0.500000
LOWER IN experimental autoimmune encephalomyelitis0.500000
experimental autoimmune encephalomyelitis0.500000
experimental cerebral malaria0.500000
malaria0.500000
dss induced colitis0.500000
LOWER IN dss induced colitis0.500000
LOWER IN il-1alpha knockout0.500000
il-1alpha knockout0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
manhatten region0.500000
LOWER IN queens region0.500000
manchester0.500000
skh-1 hairless mouse0.500000
colonic mucosa0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
zinc deficiency0.500000
low zinc diet0.500000
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
LOWER IN cefoperazone0.500000
cefoperazone0.500000
cba/j mice0.500000
LOWER IN dextran sulfate sodium0.500000
LOWER IN dss0.500000
state of maryland0.500000
LOWER IN fasting0.500000
LOWER IN every other day fasting0.500000
every other day fasting0.500000
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus1.000000
mouse0.935335
research facility0.912240
feces0.699769
united states of america0.577367
c57bl/60.341801
female0.150115
caecum0.133949
c57bl/6j0.122402
high fat diet0.099307
control0.096998
mouse chow0.094688
LOWER IN control0.085450
male0.085450
balb/c0.083141
jackson laboratories0.080831
canada0.078522
age 8 weeks0.060046
diet0.057737
colon0.050808
united kingdom0.046189
japan0.043880
charles river laboratories0.041570
taconic farms0.036952
antibiotic0.034642
LOWER IN mouse chow0.034642
brazil0.032333
manchester0.032333
south korea0.032333
state of texas0.032333
swiss webster0.032333
state of georgia0.032333
female organism0.032333
age 18 weeks0.030023
LOWER IN high fat diet0.027714
male organism0.027714
state of florida0.027714
germany0.027714
sweden0.027714
right colon0.025404
ileum0.023095
wild0.023095
janvier labs0.023095
LOWER IN feces0.020785
obesity0.020785
age 6 weeks0.020785
ketogenic diet0.020785
terminal ileum0.018476
LOWER IN antibiotic0.018476
state of oregon0.018476
iron supplemented diet0.018476
iron deficient diet0.018476
state of california0.018476
age 9 months0.018476
cecal content0.018476
state of illinois0.018476
jackson laboratory0.016166
ldlr -/-0.016166
gastrointestinal system0.016166
ldlr-0.016166
state of washington0.016166
israel0.016166
colonic mucosa0.016166
strain 129s0.016166
low fat diet0.016166
control diet0.016166
c3h/hej0.016166
state of ohio0.013857
LOWER IN colon0.013857
LOWER IN c57bl/60.013857
LOWER IN caecum0.013857
stress0.013857
c57bc/6ncrl0.013857
adult0.013857
state of maryland0.013857
c57bl/6ncrl0.013857
finland0.013857
streptomycin0.013857
adult organism0.013857
nzb/w f10.013857
australia0.013857
colonized germ free0.013857
seattle0.013857
high sugar diet0.013857
LOWER IN jackson laboratories0.011547
age 9 weeks0.011547
fasting0.011547
obese body mass index status0.011547
db/db mouse0.011547
LOWER IN late timepoints0.011547
LOWER IN stomach0.009238
stomach0.009238
LOWER IN ileum0.009238
LOWER IN taconic farms0.009238
nod mouse0.009238
house mice0.009238
new york city0.009238
city0.009238
LOWER IN fasting0.009238
tongue0.009238
Exp. ID User ID Description Date Region Flag Sequences
14amnonhighest in the right colon ( high in right colon compared to caecum in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
14amnonhighest in feces compared to colon ( high in feces compared to colon in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
14amnonmuch higher in right and transverse colon compared to other GI tract ( high in right colon transverse colon compared to left colon caecum in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v4No1 / 1
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v4No1 / 1
230amnonmouse genome dna (other mouse, mus musculus, dna)2017-11-02v4No1 / 1
230amnondominant mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 1
230amnonmouse mitochondria (other mouse, mus musculus, mitochondrion)2017-11-02v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v4No1 / 1
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 2
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
954amnonhigher in iron deficient diet in mice treated with antibiotics and salmonella ( high in iron deficient diet compared to iron supplemented diet in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse antibiotic streptomycin salmonella infections )2022-12-15v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 3
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 4
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 5
954amnon high in salmonella infections compared to control in streptomycin antibiotic mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum 2022-12-15v4No1 / 5
954amnon high in control compared to salmonella infections in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse antibiotic streptomycin 2022-12-15v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 6
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
230amnoncommon mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 9
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 9
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 11
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 12
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 12
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 12
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 12
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 12
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
710amnondominant mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 13
954amnondominant caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse, antibiotic, streptomycin2022-12-15v4No1 / 13
611amnon high in male compared to female in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 13
108amnon high in colon compared to caecum in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
954amnondominant mouse, mus musculus, research facility, c57bl/6, female organism, state of florida, united states of america, caecum, iron deficient diet2022-12-15v4No1 / 14
962amnondominant mouse, mus musculus, research facility, feces, united states of america, female organism, c57bl/6, state of rhode island2022-12-20v4No1 / 14
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 15
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 15
954amnonhigher in mice fed iron defience diet ( high in iron deficient diet compared to iron supplemented diet in mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum )2022-12-15v4No1 / 15
954amnondominant iron supplemented diet, caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 15
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 16
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 16
710amnondominant ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 16
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 17
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 17
208amnondominant mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 17
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
611amnondominant caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 18
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus colonic mucosa research facility 2022-05-20v3No1 / 18
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 18
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 18
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 19
954amnoncommon streptomycin, antibiotic, mouse, mus musculus, research facility, c57bl/6, female organism, state of florida, united states of america, caecum2022-12-15v4No1 / 19
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 19
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v4No1 / 19
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 19
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 20
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v3No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
954amnonlower in iron deficient diet in mice treated with antibiotics and salmonella ( high in iron supplemented diet compared to iron deficient diet in salmonella infections streptomycin antibiotic mouse mus musculus research facility c57bl/6 female organism state of florida united states of america caecum )2022-12-15v4No1 / 20
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 21
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v3No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 22
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 23
956amnon high in no bean flour diet compared to bean flour diet in 6-propyl-2-thiouracil high fat diet caecum research facility brazil adult organism male organism balb/c mus musculus mouse 2022-12-17v4No1 / 23
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 24
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 25
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 25
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 26
956amnondominant mouse, mus musculus, balb/c, male organism, adult organism, brazil, research facility, caecum, mouse chow2022-12-17v4No1 / 26
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 29
954amnonlower in mice fed iron defience diet ( high in iron atom iron supplemented diet compared to iron deficient diet in caecum united states of america state of florida female organism c57bl/6 research facility mus musculus mouse )2022-12-15v4No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 29
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 32
611amnon high in female compared to male in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v3No1 / 33
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 34
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
956amnon high in high fat diet 6-propyl-2-thiouracil compared to mouse chow in mouse mus musculus balb/c male organism adult organism brazil research facility caecum 2022-12-17v4No1 / 36
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 37
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
909amnon high in age 6 weeks compared to age 18 weeks in colonic mucosa manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 39
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v3No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 42
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 45
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 47
956amnon high in mouse chow compared to 6-propyl-2-thiouracil high fat diet in caecum research facility brazil adult organism male organism balb/c mus musculus mouse 2022-12-17v4No1 / 48
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 53
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 53
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 59
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 65
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 66
8amnon high in stomach compared to colon in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 68
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
386amnon high in ecuador compared to bolivia in mouse mus musculus caecum wild 2018-10-28v4No1 / 70
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 71
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v3No1 / 72
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 75
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 75
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 76
954amnoncommon iron deficient diet, caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v4No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
108amnon high in caecum compared to colon in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 86
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
962amnoncommon state of rhode island, c57bl/6, female organism, united states of america, feces, research facility, mus musculus, mouse2022-12-20v4No1 / 90
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 92
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
956amnoncommon mouse chow, caecum, research facility, brazil, adult organism, male organism, balb/c, mus musculus, mouse2022-12-17v4No1 / 103
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 106
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 110
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 119
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
954amnoncommon iron supplemented diet, , caecum, united states of america, state of florida, female organism, c57bl/6, research facility, mus musculus, mouse2022-12-15v4No1 / 120
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 120
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 120
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 121
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 129
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in mus musculus mouse feces united states of america )2017-04-14v4No1 / 131
8amnon high in colon compared to stomach in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 132
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v3No1 / 135
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 137
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 140
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
710amnoncommon mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 151
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 154
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 161
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 161
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in mus musculus house mice mouse new york city united states of america city )2018-05-18v4No1 / 162
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 163
337amnoncommon in feces of house mice from new york city (common mus musculus, house mice, mouse, new york city, united states of america, city)2018-05-18v4No1 / 165
956amnon high in bean flour diet compared to no bean flour diet in mouse mus musculus balb/c male organism adult organism brazil research facility caecum high fat diet 6-propyl-2-thiouracil 2022-12-17v4No1 / 166
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 168
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v3No1 / 170
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 188
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 189
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 190
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v4No1 / 196
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 225
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 232
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v4No1 / 238
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 295
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 325
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
710amnon high in feces compared to small intestine stomach in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 329
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
124amnoncommon mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 339
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 394
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644

Problems / suggestions? Please email info AT dbbact DOT org