Summary for ontology term: mus musculus

Number of annotations with term: 407

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.016548
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTGCAAGTCTGAAGTGAAAGCCCCGGGCTTAACCCGGGAACTGCTTTGGAAACTGTACGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.016548
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.014184
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.011820
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.011820
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGCCGGGCAAGTCCGCAGTAAAAACTGGAGGCTCAACCTTCAGGGGCTGCGGAAACTGTCCGGCTGGAGAGCAGGAGAGGACGGTGGAACTCCATGT0.011820
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTTACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTAGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.011820
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.011820
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.011820
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTACTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.011820

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTGGCAAGCCAGATGTGAAAGGCTGGGGCTCAACCCCAGGACTGCATTTGGAACTGTCATGCTAGAGTGTCGGAGAGGCAGGCGGAATTCCTAG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCGCAGGCTCAACCTGCGAACTGCATTTGAAACTGTTTCCCTTGAGTATCGGAGAGGTCATCGGAATTCCTAG0.214286
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAATGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGGAGTGAAAGGCAGGGGCCCAACCCCTGGACTGCTCTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATTCCGGGGCTCAACCCCGGACCTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCTGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGAGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.214286

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.502355
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCACGGGCTCAACCCGTGAACTGCATTTGAAACTGTTTCCCTTGAGTGTCGGAGAGGTAATCGGAATTCCTTG0.444834
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.417094
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.409722
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCGGCTAGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.408163
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTTGACAAGTCAGATGTGAAATCCTGCGGCTTAACCGCAGAACTGCATTTGAAACTGTTGATCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.398577
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.388652
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCGGCAAGTCTGAAGTGAAAGGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTGCCATGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.385321
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGCGAGAAAGTTGAATGTTAAATCTACCGGCTTAACTGGTAGCTGCGTTCAAAACTTCTTGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.382739
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGACGTGAAATTCCAGGGCTCAACCCTGGAACTGCGTTTGAAACTGTTCTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.379928

Annotations:

common ontology terms
term enrichment score
TermScore
mus musculus1.023256
mouse0.980402
research facility0.549834
c57bl/60.484607
feces0.269610
united states of america0.258099
c57bl/6j0.230435
female0.180055
high fat diet0.165414
jackson laboratories0.158371
mouse chow0.153938
caecum0.136286
balb/c0.135966
male0.132231
control0.119199
colon0.105263
LOWER IN control0.103364
age 8 weeks0.101761
diet0.100267
charles river laboratories0.083527
canada0.081731
japan0.074754
taconic farms0.074708
manchester0.066508
swiss webster0.065421
state of texas0.063016
united kingdom0.062794
age 18 weeks0.061905
LOWER IN mouse chow0.061429
state of georgia0.060475
right colon0.050633
sweden0.048290
LOWER IN high fat diet0.047733
janvier labs0.046838
ileum0.043447
ketogenic diet0.042654
age 6 weeks0.041909
germany0.041308
obesity0.041049
antibiotic0.040632
age 9 months0.037825
terminal ileum0.036446
LOWER IN antibiotic0.035582
state of oregon0.035165
cecal content0.035165
state of illinois0.034557
colonic mucosa0.033533
low fat diet0.033533
jackson laboratory0.033254
ldlr -/-0.033254
ldlr-0.033254
strain 129s0.033254
c3h/hej0.033254
brazil0.033126
gastrointestinal system0.032445
state of washington0.032184
control diet0.031842
south korea0.031809
wild0.030912
israel0.030011
LOWER IN colon0.029226
stress0.029056
c57bc/6ncrl0.028640
state of maryland0.028640
c57bl/6ncrl0.028640
nzb/w f10.028640
seattle0.028640
colonized germ free0.028640
high sugar diet0.028640
state of ohio0.027842
LOWER IN c57bl/60.027650
finland0.026726
LOWER IN caecum0.026030
state of california0.026016
LOWER IN jackson laboratories0.023981
db/db mouse0.023981
LOWER IN late timepoints0.023838
age 9 weeks0.023697
fasting0.023697
obese body mass index status0.023419
australia0.022018
LOWER IN feces0.020501
iron supplemented diet0.019370
iron deficient diet0.019370
western diet0.019370
LOWER IN taconic farms0.019277
nod mouse0.019277
house mice0.019277
LOWER IN fasting0.019277
cf-10.019277
icr/cd-1 mice0.019277
state of montana0.019093
early timepoints0.019093
state of iowa0.019093
LOWER IN balb/c0.018913
LOWER IN stomach0.018868
stomach0.018868
LOWER IN ileum0.018677
new york city0.018391
age0.018391
Fraction of dbbact annotations with this term covered by the query
TermScore
colon2.000000
LOWER IN colon1.666667
c57bl/61.055556
mus musculus1.047619
mouse1.035088
c57bl/6j1.000000
jackson laboratories1.000000
stress1.000000
LOWER IN stress1.000000
malaria1.000000
LOWER IN age 18 weeks1.000000
manchester1.000000
age 18 weeks1.000000
lumen of colon1.000000
LOWER IN lumen of colon1.000000
LOWER IN malaria1.000000
high fat diet0.916667
balb/c0.875000
LOWER IN high fat diet0.833333
LOWER IN mouse chow0.800000
taconic farms0.750000
charles river laboratories0.750000
mouse chow0.733333
colonic mucosa0.666667
LOWER IN low fat diet0.666667
low fat diet0.666667
iron supplemented diet0.666667
LOWER IN iron deficient diet0.666667
iron deficient diet0.666667
LOWER IN iron supplemented diet0.666667
swiss webster0.666667
LOWER IN western diet0.666667
western diet0.666667
LOWER IN normal diet0.600000
normal diet0.600000
LOWER IN ketogenic diet0.600000
ketogenic diet0.600000
jackson laboratory0.500000
ldlr -/-0.500000
mouse strain o1290.500000
LOWER IN transverse colon0.500000
transverse colon0.500000
LOWER IN jackson laboratories0.500000
LOWER IN taconic farms0.500000
whole grain diet0.500000
LOWER IN whole wheat diet0.500000
tcr-alpha knockout0.500000
immunization heat killed mycobacterium vaccae0.500000
LOWER IN vehicle bbs0.500000
c57bc/6ncrl0.500000
immunized with vehicle bbs0.500000
LOWER IN immunized heat killed mycobacterium vaccae0.500000
stress: chronic subordinate colony housing0.500000
LOWER IN no stress: single housed control0.500000
immunization0.500000
immunization mycobacterium vaccae0.500000
no stress: single housed control0.500000
LOWER IN stress: chronic subordinate colony housing0.500000
no immunization: vehicle as control0.500000
ldlr-0.500000
linoleic acid0.500000
LOWER IN digestive tract0.500000
digestive tract0.500000
nod mouse0.500000
LOWER IN experimental autoimmune encephalomyelitis0.500000
experimental autoimmune encephalomyelitis0.500000
experimental cerebral malaria0.500000
dss induced colitis0.500000
LOWER IN dss induced colitis0.500000
LOWER IN il-1alpha knockout0.500000
il-1alpha knockout0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
manhatten region0.500000
LOWER IN queens region0.500000
skh-1 hairless mouse0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
zinc deficiency0.500000
low zinc diet0.500000
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
LOWER IN cefoperazone0.500000
cefoperazone0.500000
LOWER IN dextran sulfate sodium0.500000
LOWER IN dss0.500000
cba/j mice0.500000
LOWER IN fasting0.500000
LOWER IN every other day fasting0.500000
state of maryland0.500000
every other day fasting0.500000
high fat diet + polydextrose0.500000
polydextrose0.500000
c57bl/6ncrl0.500000
LOWER IN high fat diet + polydextrose0.500000
LOWER IN polydextrose0.500000
harlan sprague dawley0.500000
Fraction of annotations for the query sequences containing the term
TermScore
mus musculus1.000000
mouse0.931204
research facility0.906634
feces0.724816
united states of america0.579853
c57bl/60.314496
female0.159705
c57bl/6j0.130221
control0.100737
caecum0.098280
high fat diet0.090909
male0.090909
LOWER IN control0.088452
mouse chow0.085995
jackson laboratories0.085995
canada0.083538
balb/c0.073710
age 8 weeks0.063882
diet0.061425
colon0.054054
united kingdom0.049140
japan0.046683
charles river laboratories0.044226
taconic farms0.039312
manchester0.034398
state of texas0.034398
swiss webster0.034398
state of georgia0.034398
LOWER IN mouse chow0.031941
age 18 weeks0.031941
germany0.029484
sweden0.029484
right colon0.027027
ileum0.024570
LOWER IN high fat diet0.024570
wild0.024570
janvier labs0.024570
LOWER IN feces0.022113
antibiotic0.022113
obesity0.022113
age 6 weeks0.022113
ketogenic diet0.022113
terminal ileum0.019656
LOWER IN antibiotic0.019656
brazil0.019656
state of oregon0.019656
south korea0.019656
state of california0.019656
cecal content0.019656
age 9 months0.019656
state of illinois0.019656
jackson laboratory0.017199
ldlr -/-0.017199
gastrointestinal system0.017199
state of washington0.017199
ldlr-0.017199
israel0.017199
colonic mucosa0.017199
strain 129s0.017199
low fat diet0.017199
control diet0.017199
c3h/hej0.017199
state of ohio0.014742
LOWER IN colon0.014742
LOWER IN c57bl/60.014742
LOWER IN caecum0.014742
stress0.014742
c57bc/6ncrl0.014742
adult0.014742
state of maryland0.014742
finland0.014742
c57bl/6ncrl0.014742
nzb/w f10.014742
australia0.014742
seattle0.014742
colonized germ free0.014742
high sugar diet0.014742
LOWER IN jackson laboratories0.012285
age 9 weeks0.012285
fasting0.012285
obese body mass index status0.012285
db/db mouse0.012285
LOWER IN late timepoints0.012285
LOWER IN stomach0.009828
stomach0.009828
LOWER IN ileum0.009828
LOWER IN taconic farms0.009828
nod mouse0.009828
city0.009828
new york city0.009828
house mice0.009828
LOWER IN fasting0.009828
tongue0.009828
LOWER IN balb/c0.009828
age0.009828
iron supplemented diet0.009828
state of montana0.009828
iron deficient diet0.009828
early timepoints0.009828
switzerland0.009828
Exp. ID User ID Description Date Region Flag Sequences
14amnonhighest in the right colon ( high in right colon compared to caecum in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
14amnonhighest in feces compared to colon ( high in feces compared to colon in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
14amnonmuch higher in right and transverse colon compared to other GI tract ( high in transverse colon right colon compared to caecum left colon in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse)2019-01-10v4No1 / 1
230amnonmouse mitochondria (other mus musculus, mitochondrion, mouse)2017-11-02v4No1 / 1
230amnonmouse mitochondria (other mus musculus, mitochondrion, mouse)2017-11-02v4No1 / 1
230amnonmouse genome dna (other dna, mus musculus, mouse)2017-11-02v4No1 / 1
230amnondominant united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in feces caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 1
124amnonassociated with glucose tolerance (other feces, caecum, mus musculus, c57bl/6j, mouse, glucose tolerance)2017-04-14v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 2
123amnon high in olanzapine compared to control in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 3
456amnonreagent contaminant (high in blanks) in mouse nasopharynx study (contamination)2019-01-10v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 3
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in feces united states of america mus musculus balb/c state of texas mouse )2017-10-06v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in diet american diet compared to bangladesh diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to body mass index high growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 4
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 6
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 7
179amnondominant united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 7
217amnondominant feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
167amnondominant feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
230amnoncommon united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 9
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 9
456amnondominant tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 9
321amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to age aging old age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
413amnondominant feces, research facility, mus musculus, c57bl/6j, mouse, mouse chow, jackson laboratory, ldlr -/-2018-11-26v4No1 / 11
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 11
386amnondominant caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 11
413amnondominant feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 12
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
328amnondominant feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 12
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
399amnondominant feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 12
123amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 12
307amnondominant feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 13
441amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in diet bangladesh diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
611amnon high in male compared to female in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 13
108amnon high in colon compared to caecum in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
866amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus balb/c japan )2016-12-10v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 14
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
386amnondominant caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 14
494amnondominant research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 15
326amnondominant united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 15
328amnondominant research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 15
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
456amnoncommon tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
457amnondominant feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 15
708amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 15
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
494amnondominant research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 15
844amnondominant feces, research facility, mus musculus, c57bl/6, australia, mouse, iron deficient diet2021-11-17v3No1 / 15
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 15
211amnonHigh freq. in multiple mouse strains feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
208amnondominant feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 17
212amnondominant feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
369amnondominant feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
386amnondominant caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 17
611amnondominant research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 17
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 18
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 18
214amnondominant feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
119amnondominant feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 18
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 19
503amnondominant feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 19
216amnondominant feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
844amnondominant feces, research facility, mus musculus, c57bl/6, australia, mouse, iron supplemented diet2021-11-17v3No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 19
866amnondominant feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
328amnonlower in feces compared to intestinal mucosa in mice ( high in intestine mucosa digestive tract compared to feces in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 20
457amnondominant feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 20
188amnondominant feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 20
368amnondominant feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 20
476amnondominant feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 21
503amnondominant feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 21
108amnondominant united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 21
124amnondominant feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 22
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
334amnondominant feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 22
219amnonhigh freq. in mother mice feces (dominant feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 22
248amnondominant feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 23
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in vaccination immunization heat killed mycobacterium vaccae compared to vehicle bbs in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 24
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
909amnondominant feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
108amnondominant united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 25
909amnondominant feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 26
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 27
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
885amnondominant feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 29
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 31
885amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 32
611amnon high in female compared to male in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 33
866amnon high in iga positive fraction compared to iga negative fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 34
909amnon high in feces compared to lumen of colon in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in feces united states of america research facility mus musculus mouse cba/j mice )2017-08-24v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 37
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
909amnon high in age 6 weeks compared to age 18 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 39
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 42
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
866amnon high in stress restraint stress compared to control in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 45
211amnon high in male compared to female in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in iron deficient diet low iron compared to iron iron supplemented diet in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 47
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
14amnon high in feces caecum transverse colon left colon right colon compared to stomach duodenum jejunum ileum in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 51
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 51
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 51
413amnon high in high fat diet compared to mouse chow in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
909amnon high in lumen of colon compared to feces in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 53
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 53
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 60
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron deficient diet2021-11-17v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to high fat diet western diet very high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 60
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 62
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
326amnon high in diet high fat diet compared to mouse chow in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 65
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 66
8amnon high in stomach compared to colon in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 68
211amnonCommon in multiple mouse strains feces (common feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 68
896amnon high in starch diet compared to glucose diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 70
386amnon high in ecuador compared to bolivia in caecum mus musculus mouse wild 2018-10-28v4No1 / 70
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in diet whole grain diet compared to normal diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 71
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 72
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 73
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
866amnon high in iga negative fraction compared to iga positive fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 76
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron supplemented diet2021-11-17v3No1 / 85
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
108amnon high in caecum compared to colon in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 86
214amnoncommon feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 89
399amnoncommon feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 89
386amnoncommon caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 90
503amnon high in balb/c compared to c57bl/6 in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 91
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 92
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to intestine mucosa digestive tract in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 94
214amnoncommon feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 95
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 97
441amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 100
413amnoncommon feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 101
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 106
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 108
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 108
328amnoncommon research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 109
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
217amnoncommon feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
328amnoncommon feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 116
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 120
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 121
326amnoncommon united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 122
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 122
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
458amnoncommon in mice strains from jackson laboratories (common feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 129
386amnoncommon caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 129
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in feces united states of america mus musculus mouse )2017-04-14v4No1 / 131
8amnon high in colon compared to stomach in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 132
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 139
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 140
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 145
611amnoncommon research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
307amnoncommon feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 148
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
866amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 152
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 153
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 155
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
909amnoncommon feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
368amnoncommon feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 161
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 162
413amnon high in mouse chow compared to high fat diet in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 163
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
456amnoncommon united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 167
909amnoncommon feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
457amnoncommon feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 168
885amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 170
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
321amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 183
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
458amnoncommon in mice strains from harlan sprague dawley (common feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 184
188amnoncommon feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 185
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 186
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 186
885amnoncommon feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 188
326amnon high in diet mouse chow compared to high fat diet in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 189
386amnoncommon caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 189
413amnoncommon feces, research facility, mus musculus, c57bl/6j, mouse, mouse chow, jackson laboratory, ldlr -/-2018-11-26v4No1 / 190
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 193
866amnon high in control compared to stress restraint stress in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 196
372amnon high in high fat diet compared to mouse chow in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 199
334amnoncommon feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
248amnoncommon feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 203
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 207
123amnon high in diet normal diet regular mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 209
503amnoncommon feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 210
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 224
369amnoncommon feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 225
42amnoncommon in tcr-b deficient balb/c mice (common feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 227
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
708amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 232
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
896amnon high in glucose diet compared to starch diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 238
119amnoncommon feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 239
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
386amnon high in bolivia compared to ecuador in caecum mus musculus mouse wild 2018-10-28v4No1 / 246
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 255
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 257
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 265
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
494amnoncommon research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 275
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 284
494amnon high in mouse chow compared to diet high fat diet western diet in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 293
708amnonlower in mice with iron deficient diet ( high in iron iron supplemented diet compared to iron deficient diet low iron in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 295
476amnoncommon feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 299
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
13amnon high in feces rectum caecum colon compared to stomach esophagus duodenum ileum mouth in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 316
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
123amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 325
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
447amnoncommon united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 328
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
456amnon high in caecum compared to tongue in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 338
124amnoncommon feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 339
447amnoncommon united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 343
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 379
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to balb/c a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 380
216amnoncommon feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 385
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 394
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644

Problems / suggestions? Please email info AT dbbact DOT org