Summary for ontology term: nanchang city prefecture

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGTCACGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGAGCAGGCGGCTTGGCAAGTCTGGGGTGAAAGAATGGGGCTCAACCCCATCCAGCCTTGGAAACTACCTGGCTAGAGTGCGCGAGAGGTTAACGGAACTCCATGT0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCACAGGCCGGCTGTCAAGCGTGTTGTGAAATGTAGGGGCTCAACCTCTGAACTGCAGCGCGAACTGACGGTCTTGAGTGCGCGCAACGTTGGCGGAATTCGTCG0.210526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCGTGGGCTCAACCCACGAACTGCATTTGAAACTGTGGATCTTGAGTATCGGAGAGGTAATCGGAATTCCTTG0.200000
d__BacteriaTACGTAGGGGGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGTGCGCAGGTGGCCCGACAAGTCTGGCGTTAAAGTGCGGGGCTCAACTCCGTGATGCGCTGGAAACTGTCTGGCTTGAGTACAGCAGGGGGCGTCGGAATTCCAGGT0.190476
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTTTTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT0.190476
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 2;g__AlkaliphilusTACGTAGGGGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGCTGCCCTATAGGTCAGAGGTCAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGTAGGGCTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.190476
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCACAGGCCGGCTGTCAAGCGTGTTGTGAAATGTAGGGGCTCAACCTCTGAACTGCAGCGCGAACTGACGGTCTTGAGTGCGCACAACGTTGGCGGAATTCGTCG0.190476
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTGTGTAAGTCAGATGTGAAATCCGCGGGCTCAACCCGCGAACTGCATTTGAAACTGCGCATCTTGAGTATCGGAGAGGTAATCGGAATTCCTTG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__OscillibacterTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTCGGCAAGTCAGATGTGAAATCTGGAGGCTCAACCTCCAAACTGCATTTGAAACTGTTGATCTTGAGTATCGGAGAGGTAACCGGAATTCCTTG0.181818
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__DesulfovibrioTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCTGTCGTGTAAGTCAGGGGTGAAAGCCCACGGCTCAACCGTGGAATTGCCCTTGATACTGCATGACTGGAATCCGGGAGAGGGTAGTGGAATTCCAGG0.181818

Annotations:

common ontology terms
term enrichment score
TermScore
nanchang city prefecture0.800000
acute pancreatitis0.461538
pancreatitis0.461538
duroc pig0.444444
age 140 days0.444444
LOWER IN acute pancreatitis0.181818
LOWER IN pancreatitis0.181818
sus scrofa0.108108
pig0.108108
male organism0.105263
LOWER IN male organism0.105263
LOWER IN female organism0.086957
female organism0.086957
male0.046512
LOWER IN male0.046512
LOWER IN female0.027397
female0.027397
china0.022989
research facility0.013378
feces0.012658
adult0.011450
control0.010619
LOWER IN control0.010256
homo sapiens0.007335
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
acute pancreatitis1.000000
pancreatitis1.000000
nanchang city prefecture0.666667
duroc pig0.500000
age 140 days0.500000
male organism0.111111
LOWER IN male organism0.111111
LOWER IN female organism0.076923
female organism0.076923
sus scrofa0.062500
pig0.062500
male0.030303
LOWER IN male0.030303
LOWER IN female0.015873
female0.015873
china0.011628
research facility0.006803
feces0.006369
adult0.005780
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
nanchang city prefecture1.000000
china1.000000
homo sapiens0.600000
adult0.600000
research facility0.400000
sus scrofa0.400000
pig0.400000
duroc pig0.400000
age 140 days0.400000
control0.300000
acute pancreatitis0.300000
pancreatitis0.300000
LOWER IN acute pancreatitis0.100000
LOWER IN pancreatitis0.100000
LOWER IN control0.100000
male0.100000
male organism0.100000
LOWER IN female0.100000
LOWER IN female organism0.100000
female0.100000
female organism0.100000
LOWER IN male0.100000
LOWER IN male organism0.100000

Problems / suggestions? Please email info AT dbbact DOT org