Summary for ontology term: neomycin

Number of annotations with term: 8

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGAGCGTAGGCGGCACTACAAGTCTCATGTGAAATACCCGGGCTTAACTTGGGGGTTGCATGGGAAACTGTAGAGCTTGAGTACAGGAGAGGCAAGCGGAATTCCTAG0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAAACGCGGGGCTCAACTCCGCGCGTGCAGTGGGTACGGGCAGGCTGGAGTGCGGCAGGGGTGGCTGGAATTCCTGG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACCCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.142857

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCTCTGGGCTCAACCCAGAAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAATTATGGGCTCAACCCATAACCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.666667
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGGAACTTAAGTTAGATGTGAAAACTCCGGGCTCAACCTGGAGACTGCATTTAAAACTGGGTTTCTTGAGGGCAGGAGAGGAAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGCCTGGAGTGAAAGGATGGGGCCCAACCCCATGACTGCTCTGGGAACTGCGCGGCTGGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTTTAGCAAGTCAGAAGTGAAAGCCCGCAGCTCAACTGGGGGACTGCTTTTGAAACTGTTAAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGAGCAAGTCTGAAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGCAAAGCTAGAGTACAGGAGGGGCAGGCGGAATTCCTGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGGTTGCAAGTCAGGCGTGAAATCCATCGGCTTAACCGGTGAACTGCGCTTGAAACTGTAATTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCGAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAGGCGGGGGCTCACCCCCCGGACTGCATTGGAAACTGTATTTCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.222222
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTGTTAAGTATAAGATAAAAGCCCGGGGCTCAACTCCGGTTCGTCTTATAAACTGGCAGACTTGAGTGTGGTAGAGGCAAGTGGAATTTCTAGT0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGGTTGCAAGTCAGGCGTGAAATCCATCGGCTTAACCGGTGAACTGCGCTTGAAACTGTAATTCTTGAGTGAAGTAGAGGCAGGCGGGATTCCGAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCATGTAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAGACTGTGTGGCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCCCGCCAAGTCTGATGTGAAATACCGGGGCTCAACCCCGGGGCTGCATTGGAAACTGGCAGGCTGGAGTGTCGGAGAGGCAGGCGGGATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCTGGAGGGTCTATTGTTAAAAGGCAATGGCTTAACCATTGCAAGGCGAAGAAACCGGCAGGCTAGAGTTCTAAAGAGGATCGTGGAATTCCATG0.222222
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTGATTAAGTCAGATGTGAAATACCCGGGCTTAACCTGGGGGGTGCATCTGAAACTGGTTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATGCAAGTCTGAAGTGAAAGCCCGTGGCTTAACCGCGGAACGGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.222222

Annotations:

common ontology terms
term enrichment score
TermScore
neomycin0.750000
ampicillin0.387097
LOWER IN neomycin0.333333
antibiotic0.300000
vancomycin0.300000
sprague dawley0.285714
rattus norvegicus0.222222
metronidazole0.206897
rat0.181818
LOWER IN antibiotic0.166667
LOWER IN vancomycin0.166667
LOWER IN ampicillin0.153846
switzerland0.153846
LOWER IN metronidazole0.133333
israel0.095238
state of california0.071429
male0.054054
caecum0.050000
research facility0.026490
control0.020725
LOWER IN control0.020725
feces0.018927
adult0.011429
united states of america0.008032
homo sapiens0.007326
Fraction of dbbact annotations with this term covered by the query
TermScore
neomycin0.750000
LOWER IN neomycin0.500000
ampicillin0.400000
vancomycin0.250000
LOWER IN vancomycin0.250000
LOWER IN ampicillin0.200000
sprague dawley0.200000
antibiotic0.187500
rattus norvegicus0.142857
metronidazole0.142857
LOWER IN metronidazole0.142857
LOWER IN antibiotic0.125000
switzerland0.111111
rat0.111111
israel0.058824
state of california0.038462
male0.030303
caecum0.027778
research facility0.013605
control0.010811
LOWER IN control0.010811
feces0.009554
adult0.005780
united states of america0.004049
homo sapiens0.003690
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
antibiotic0.750000
neomycin0.750000
research facility0.500000
rattus norvegicus0.500000
sprague dawley0.500000
rat0.500000
homo sapiens0.500000
united states of america0.500000
adult0.500000
state of california0.500000
ampicillin0.375000
vancomycin0.375000
metronidazole0.375000
control0.250000
LOWER IN antibiotic0.250000
LOWER IN neomycin0.250000
caecum0.250000
switzerland0.250000
LOWER IN control0.250000
israel0.250000
male0.250000
LOWER IN ampicillin0.125000
LOWER IN vancomycin0.125000
LOWER IN metronidazole0.125000
Exp. ID User ID Description Date Region Flag Sequences
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301

Problems / suggestions? Please email info AT dbbact DOT org