Summary for ontology term: neonate

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCACGGGCTTAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.200000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.200000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTTTAAGATAAAAGCCTGAGGCTCAACCTCAGTTCGTCTTAAAAACTGGTAGACTAGAGTATGGTAGAGGCAAACGGAATTTCTAGT1.000000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGCGTGTGTAGGCGGGAAATTAAGTCTAAGGTTTAAGCCCGGAGCTCAACTCCGGTTCGCCTTAGAAACTGATTTTCTTGAGTGTGGTAGAGGCAAACGGAATTTCTAGT1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACCCTGGGACTGCTTTTGAAACTGTCAGACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG1.000000
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTGTTTAAGTCAGATGTGAAATACCCGGGCTTAACTCGGGGGCTGCATCTGATACTGGATGACTAGAGTGCAGGAGAGGAAAGTGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGGAAGCAAGTCAGACGTGAAAACTATGGGCTCAACCCATAACGTGCGTTTGAAACTGTTTTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG1.000000
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGAGTAGGCGGGCAGACAAGTCAGATGTGAAAAATACGGGCTCAACCCGTATCTTGCATTTGAAACTGTAGGTCTTGAGTATGGGAGAGGTAAACGGAATTCCCGG1.000000
d__BacteriaTACGTAGGGTCCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGACGGCATAGCAAGTCAGATGTGAAAACTTAGAGCTCAACTTTAAGACTGCATCTGAAACTGTTAAGCTAGAGTGCAGAAGAGGTAAGTGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGAAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTTAAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG1.000000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCCGGTAAGTCAGATGTGAAAAGTGAGGGCTCAACCCTTAGAGTGCATCTGATACTGTCGGGCTTGAGTACAGAAGAGGAAAGCGGAATTCCTAG1.000000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTGACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FlavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACTGGGGGCTCAACCTCCAGCTTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAGT0.285714
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGTG0.285714
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGGT0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGT0.285714
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGGT0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGT0.285714
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCACGGGCTTAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.142857

Annotations:

common ontology terms
term enrichment score
TermScore
neonate0.857143
state of washington0.400000
LOWER IN neonate0.400000
age 1 week0.375000
macaca mulatta0.285714
LOWER IN age 1 week0.250000
juvenile organism0.200000
LOWER IN juvenile organism0.200000
monkey0.133333
research facility0.013514
united states of america0.008065
feces0.006349
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
neonate1.000000
LOWER IN neonate1.000000
state of washington0.250000
age 1 week0.250000
LOWER IN age 1 week0.250000
macaca mulatta0.166667
juvenile organism0.166667
LOWER IN juvenile organism0.166667
monkey0.071429
research facility0.006803
united states of america0.004049
feces0.003185
age 20 months0.000000
LOWER IN age 20 months0.000000
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
macaca mulatta1.000000
state of washington1.000000
monkey1.000000
age 1 week0.750000
neonate0.750000
juvenile organism0.250000
age 20 months0.250000
LOWER IN age 1 week0.250000
LOWER IN neonate0.250000
LOWER IN juvenile organism0.250000
LOWER IN age 20 months0.250000

Problems / suggestions? Please email info AT dbbact DOT org