Summary for ontology term: new york county

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AnaerotruncusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATGCCAAGTAGAATGTTAAATCCATCGGCTCAACTGGTGGCAGCGTTCTAAACTGGCGTTCTTGAGTGAGGTAGAGGCAGGCGGAATTCCTAGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGTGGTCTGTTAAGTCAGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.074074
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGATGGCAAGTCAGATGTGAAATACCGGGGCTTAACTCCGGGGCTGCATTTGAAACTGTCGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.064516
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTATGTAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.043478
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.041667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__EisenbergiellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAACCCAGGGCTCAACCTTGGGATTGCATTTGGAACTGCCAGGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.040816
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGATGTGAAAACTTGGGGCTCAACCCCAAGACTGCATTGGAAACTGTTAAGCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.040816
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCATGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.040816
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGGAGTGAAATCCATGGGCTCAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.038462
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGCGAGGCAAGTCAGCGGTCAAATGTCGGGGCTCAACCCCGGCCTGCCGTTGAAACTGTCCTGCTAGAGTTCGAGTGAGGTATGCGGAATGCGTTGT0.028571

Annotations:

common ontology terms
term enrichment score
TermScore
new york county0.666667
chronic fatigue syndrome0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN control0.010695
control0.010695
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
chronic fatigue syndrome0.500000
new york county0.500000
LOWER IN chronic fatigue syndrome0.500000
LOWER IN control0.005405
control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
new york county1.000000
chronic fatigue syndrome0.500000
LOWER IN control0.500000
control0.500000
LOWER IN chronic fatigue syndrome0.500000

Problems / suggestions? Please email info AT dbbact DOT org