Summary for ontology term: non usa born

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.500000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAATCAAGTTGGATGTGAAATGTCGGGGCTTAACCCCGGAACTGCATCCAAAACTGATATTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGCGGCGTAAGTCAGTTGTGAAATCGTGCGGCTTAACCGTGCAATTGCAGTTGATACTGCGTCGCTTGAGTGCACACAGGGATGTTGGAATTCATGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGTAGGCCGCCTTTTAAGCGTGTTGTGAAATGTAGGGGCTCAACCCCTGCACTGCAGCGCGAACTGGAGGGCTTGAGTACACACAAAGTAGGCGGAATTCATGG0.500000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTTATAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTGAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SenegalimassiliaTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGAGCGCTAAGCGGGACCTCTAACCCGAGGGCTCAACCCCCGGCCGGGTCCCGAACTGGCGCTCTCGAGTGCGGTAGGGGAGAGCGGAATTCCCGGT0.500000
d__BacteriaTACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCTGTGCGTCAAGTCGGGGGTGAAATTCCGGTGCTCAACACCGGGGCTGCCCTTGATACTGTCGCGCTGGAGTGCGGATGCCGCCGGAGGAATGAGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCGGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGCGCAGTTAGTCAGAAGTGAAATATCGGGGCTTAACCCCGGGGCTGCTTCTGATACTGCTGTGCTTGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCTTGGTAAGTCAGAAGTGAAAGCCCAGGGCTTAACCCTGGGACTGCTTTTGAAACTGCCAGGCTTGATTGCCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGACGGTAAGTCAGCTGTGAAAGGTACAGGCTCAACCTGTGCACTGCAGTTGAAACTGCTGTTCTTGAGTAGAGGAGAGGTAAACGGAATTCCCAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGGCGTGAAAACCAGGGGCTCAACCTCTGGCCTGCGTTTGAAACTGTAGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGGCTGGTAAGTTGGAAGTGAAATCTGGGGGCTCAACCCCCAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGTCTCAAGTCGAATGTTAAATCTACCGGCTCAACTGGTAGCTGCGTTCGAAACTGGGGCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGGAAGTGAAATGCATGGGCTCAACCCATGAGCTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCAGAGCAAGTCAGGCGTGAAAGCCATGGGCTTAACCCATGAACTGCGCTTGAAACTGTTTTGCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGAGATCAAGTCAGTTGTGAAAAGCAGCCGCTCAACGGTTGTCGTGCAGTTGATACTGGTTTTCTTGAGTGCGCGCGAGGATGGTGGAATTTGTGG0.166667
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGCTGAGCAAGTTGGTAGTGAAATTCCGAGGCTTAACTTCGGCGCTACTACCAAGACTGCCCGGCTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.153846
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGTGCAAGTTGAATGTTTAATCTATGGGCTCAACCCATATCAGCGTTCAAAACTGCATTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCTAGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGGTGCAAGTCAGAAGTGAAATCCACGGGCTTAACTCGTGAACTGCTTTTGAAACTGTACCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.095238
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTACGTCAGAGGGGGGTGGAATTCCACG0.095238
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATACAAGTTGAATGTTAAAACTATGGGCTCAACCCATAGTTGCGTTCAAAACTGTATTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAGT0.090909
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGTCAGATGTGAAATACTGGGGCTCAACCCCGGGACTGCATTTGAAACTGTCCGGCTAGAGTGCAGGAGAGGCAGGCGGAATTCCTAG0.086957
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTACGTCAGAGGGGGGTGGAATTCCACG0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGAGGCAAGTCTGAAGTGAAATGCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTCTGACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.083333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGGTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.080000

Annotations:

common ontology terms
term enrichment score
TermScore
non usa born0.500000
LOWER IN usa born0.500000
usa born0.500000
LOWER IN non usa born0.500000
hispanic or latin american0.400000
adult0.011494
united states of america0.008065
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
non usa born0.500000
LOWER IN usa born0.500000
usa born0.500000
LOWER IN non usa born0.500000
hispanic or latin american0.250000
adult0.005780
united states of america0.004049
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america1.000000
adult1.000000
hispanic or latin american1.000000
non usa born0.500000
LOWER IN usa born0.500000
usa born0.500000
LOWER IN non usa born0.500000

Problems / suggestions? Please email info AT dbbact DOT org