Summary for ontology term: non-steroidal anti-inflammatory drug

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGAGCAAGTCGACTGTGAAATCTATGGGCTTAACCCATAGCTGCGATCGAAACTGTTCATCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAGTGCAAGTCAGATGTGAAATCCCGCGGCTCAACCGCGGAACTGCATTTGAAACTGTGCTTCTTGAGTGCTGGAGAGGCAGACGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATATTAAGTTGAATGTATAAACTACCGGCTTAACCGATAGAAGCGTTCAAAACTGATATTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCAAGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCATGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGACGGGAAAGCAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTACTTTTCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTTCGGAATGACTGGGCGTAAAGGGTGTGTAGGTGGTTTGATAAGTTAGATGTGTAATACCCAGGGCTTAACTCGGGTGCTGCATCTAAAACTGTTAGACTTGAGTACTGGAGAGGATAGTGGAATTCCTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTATAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGTAACTTGAGTACAGGAGGGGCAGGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGTAATGCAAGTCTGGAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTCTGGAAACTGTGTAACTGGAGTGCAGGAGAGGCAGGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGATGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTGTGACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGTGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTGCTGCTAGAGTGTCGGAGAGGCAGGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCGTGGCAAGTCAGATGTGAAAACCCGGGGCCCAACCTCGGGAGTGCATTTGAAACTGCCATGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__PseudoflavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTAGTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTGCGGCTGGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGTAAGCCTGAAGTGGAAGCCCGCGGCCCAACCGCGGAACTGCTTTGGGAACTGTTTTGCTGGAGTATGGGAGGGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCGTGGCAAGTCAGATGTGAAAACCCGGGGCCCAACCCCGGGAGTGCATTTGAAACTGCCATGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCGCCAAGCTGGGTGTGAAAGGCCGGGGCTCAACCCCGGGACTGCACTCGGAACTGGCGTGCTAGAGTGTTGGAGAGGTAAGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGTCTAAAATAAAAGCCCGAAGCTTAACTTCGGTTCGTTTTAGAAACTGGCAGGCTTGAGTATGGTAGAGGCAAACGGAATTTCTAGT0.400000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGTCAAGTTGGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACCAAAACTAACTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGACGTGAAATTCCAGGGCTCAACCCTGGAACTGCGTTTGAAACTGTTCTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGGG0.166667
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTAGTTGTGAAATCCCTCAGCTTAACTGAGGAACTGCAACTAAAACTATTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTAAGCAAGTCTGAAGTGAAAGGCGGGGGCTCAACCCCCGGACTGCTTTGGAAACTGTATGACTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGCCTGCCAAGTCTGATGTGAAATACCGGGGCTCAACCCCGGGGCTGCATTGGAAACTGGCAGGCTGGAGTGCCGGAGAGGCAGGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGTCAGATGTGAAAACCCGGGGCCCAACCCCGGGAGTGCATTTGAAACTGTCTGGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.100000
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAGGTCTAAAATTAAAGTCCGAAGCTTAACTTCGGTTCGTTTTAGAAACCGGCAGGCTTGAGTATGGTAGAGGCAAACGGAATTTCTAGT0.090909
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGTATATAAGTTAGTTGTGAAATCCCTCGGCTCAACTGAGGAACTGCAACTAAAACTGTAAATCTTGAGTGCGGGAGAGGAAAGTGGAATTCCTAG0.090909
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGTAATACAGGTCTTTGGTATAAGCCCGAAGCTTAACTTCGGTAAGCCAGAGAAACCGTATAACTAGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.090909

Annotations:

common ontology terms
term enrichment score
TermScore
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
c57bl/6j0.166667
mouse0.030769
mus musculus0.027778
research facility0.011111
LOWER IN control0.010101
control0.009852
united states of america0.007067
feces0.005208
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
c57bl/6j0.090909
mouse0.015625
mus musculus0.014085
research facility0.005587
LOWER IN control0.005102
control0.004975
united states of america0.003546
feces0.002611
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
mus musculus1.000000
c57bl/6j1.000000
mouse1.000000
control0.500000
LOWER IN non-steroidal anti-inflammatory drug0.500000
LOWER IN indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
indomethacin0.500000
LOWER IN control0.500000
Number of experiments associating the term to the sequence
TermScore
control1.000000
LOWER IN non-steroidal anti-inflammatory drug1.000000
LOWER IN indomethacin1.000000
feces1.000000
united states of america1.000000
research facility1.000000
mus musculus1.000000
c57bl/6j1.000000
mouse1.000000
non-steroidal anti-inflammatory drug1.000000
indomethacin1.000000
LOWER IN control1.000000

Problems / suggestions? Please email info AT dbbact DOT org