Summary for ontology term: nonmeat part of animal

Number of annotations with term: 2826

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.003595
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.003235
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.002876
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.002876
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.002876
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.002516
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.002516
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.002516
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.002516
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.002516

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.213333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.146667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.146667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.146667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.146667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGTGGCCAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTGGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.146667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.133333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.133333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGCGGTGAAATCTAGGAGCTTAACTCCTAAATTGCCATTGAAACTGGCGGGCTTGAGTGTAGATGAGGTAGGCGGAATGCGTGG0.133333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.341400
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.308514
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.290754
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.281707
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.279914
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.268575
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.251718
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.249454
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.247803
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.243529

Annotations:

common ontology terms
term enrichment score
TermScore
feces0.918100
homo sapiens0.640212
adult0.408119
united states of america0.406841
research facility0.282790
mus musculus0.194204
mouse0.180451
saliva0.177961
china0.174772
child0.172648
control0.156507
infant0.125430
female0.108095
LOWER IN control0.098465
wild0.087455
canis lupus familiaris0.082865
captive0.081225
italy0.076440
monkey0.076424
zoological garden0.075150
dog0.075071
male0.066528
c57bl/60.065330
farm0.054383
germany0.052605
human adult stage0.051264
rural community0.050532
supragingival plaque0.049955
supragingival dental plaque0.048735
kingdom of spain0.048132
rat0.045910
state of california0.045834
australia0.044564
adult organism0.042110
city0.041527
sweden0.041453
mucus0.040762
canada0.040139
japan0.039002
c57bl/6j0.036751
obesity0.035499
dentition0.034002
female organism0.032424
bird0.031894
rattus norvegicus0.031653
commonwealth of pennsylvania0.031293
subgingival plaque0.031104
subgingival dental plaque0.030820
macaca mulatta0.029217
equus caballus0.028449
2-5 year-old child stage0.028255
sprague dawley0.027747
israel0.027482
united kingdom0.026998
horse0.026337
rumen0.025892
ruminal fluid0.025847
state of new york0.025564
sus scrofa0.024913
6-year-old human stage0.024567
obsolete_juvenile stage0.024269
south korea0.024171
bos taurus0.024005
french republic0.023940
thailand0.023776
nigeria0.023085
pig0.022880
coral0.022442
ulcerative colitis0.022348
mouse chow0.022269
1-year-old human stage0.022235
cow0.022186
kenya0.022145
high fat diet0.021654
amsterdam0.020953
formula fed0.020935
periodontitis0.020821
rectal swab0.020350
jackson laboratories0.020281
antibiotic0.020213
ocean0.020178
kingdom of the netherlands0.020111
LOWER IN feces0.019689
2-year-old human stage0.019622
crohn's disease0.019569
state of texas0.019558
hispanic or latin american0.019558
pregnancy0.019536
state of georgia0.019507
oral cavity0.019244
no dental caries0.019017
felis catus0.018905
india0.018902
1-month-old human stage0.018892
homosexual0.018892
msm0.018892
russia0.018826
diet0.018619
south africa0.018447
rhesus macaque0.018233
Fraction of dbbact annotations with this term covered by the query
TermScore
9-month-old human stage2.000000
no dental caries2.000000
marmosets2.000000
macaca nemestrina2.000000
supragingival dental plaque1.500000
6-year-old human stage1.500000
subgingival dental plaque1.500000
18-month-old human stage1.500000
4-year-old human stage1.500000
LOWER IN 4-year-old human stage1.500000
LOWER IN dental caries1.333333
dental caries1.333333
supragingival plaque1.272727
obese body mass index status1.250000
type 2 diabetes mellitus1.250000
rectal swab1.200000
rural community1.153846
captive1.142857
saliva1.127660
feces1.107246
obesity1.076923
monkey1.066667
daxin county1.000000
3-year-old human stage1.000000
latvia1.000000
remission1.000000
LOWER IN remission1.000000
irkutsk1.000000
child1.000000
glasgow1.000000
plant based diet1.000000
LOWER IN plant based diet1.000000
fire salamander1.000000
2-year-old human stage1.000000
state of oklahoma1.000000
vervet monkey1.000000
6-month-old human stage1.000000
serinus canaria1.000000
canary1.000000
nigeria1.000000
chimpanzee1.000000
gorilla gorilla1.000000
macaque1.000000
thailand1.000000
anal swab1.000000
ruminal fluid1.000000
viet nam1.000000
third trimester1.000000
pan paniscus1.000000
bonobo1.000000
7-year-old human stage1.000000
LOWER IN type 2 diabetes mellitus1.000000
milk1.000000
village1.000000
8-year-old human stage1.000000
rhesus macaque1.000000
overweight body mass index status1.000000
vegetarian diet1.000000
LOWER IN vegetarian diet1.000000
wildlife sactuary1.000000
dog food diet1.000000
LOWER IN 18-month-old human stage1.000000
hangzhou city prefecture1.000000
LOWER IN hydrolized diet1.000000
hydrolized diet1.000000
forest musk deer1.000000
moschus berezovskii1.000000
auckland city1.000000
gambia1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
interproximal dental plaque1.000000
lingual dental plaque1.000000
vestibular dental plaque1.000000
LOWER IN interproximal dental plaque1.000000
LOWER IN lingual dental plaque1.000000
orenburg1.000000
licosa island1.000000
podarcis siculus1.000000
lizard1.000000
punta licosa1.000000
LOWER IN punta licosa1.000000
LOWER IN licosa island1.000000
riwoqe county1.000000
age 4-7 years1.000000
kazakhstan1.000000
pig farm1.000000
chicken farm1.000000
LOWER IN chicken farm1.000000
LOWER IN pig farm1.000000
cardiovascular risk group1.000000
coats island1.000000
thick-billed murres1.000000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.784147
homo sapiens0.508139
united states of america0.317056
adult0.268577
research facility0.189667
china0.118896
mus musculus0.110403
mouse0.101911
saliva0.096603
child0.094480
control0.088818
infant0.067233
female0.058386
LOWER IN control0.053432
wild0.046001
canis lupus familiaris0.043524
captive0.042109
italy0.040340
monkey0.039632
dog0.039278
zoological garden0.039278
male0.035032
c57bl/60.033970
germany0.029016
farm0.029016
human adult stage0.027247
rural community0.025832
supragingival plaque0.025478
kingdom of spain0.025124
supragingival dental plaque0.024770
state of california0.024062
australia0.023708
rat0.023708
sweden0.021939
city0.021585
adult organism0.021585
canada0.021231
mucus0.020878
japan0.020170
c57bl/6j0.018754
obesity0.018047
dentition0.017693
female organism0.016631
bird0.016277
rattus norvegicus0.016277
subgingival plaque0.015924
commonwealth of pennsylvania0.015924
subgingival dental plaque0.015570
macaca mulatta0.014862
equus caballus0.014508
2-5 year-old child stage0.014508
united kingdom0.014154
israel0.014154
sprague dawley0.014154
horse0.013447
rumen0.013447
state of new york0.013093
ruminal fluid0.013093
sus scrofa0.012739
obsolete_juvenile stage0.012385
south korea0.012385
french republic0.012385
bos taurus0.012385
6-year-old human stage0.012385
thailand0.012031
coral0.012031
ocean0.012031
nigeria0.011677
pig0.011677
ulcerative colitis0.011323
LOWER IN feces0.011323
1-year-old human stage0.011323
kenya0.011323
mouse chow0.011323
cow0.011323
high fat diet0.010970
amsterdam0.010616
periodontitis0.010616
formula fed0.010616
antibiotic0.010262
jackson laboratories0.010262
rectal swab0.010262
kingdom of the netherlands0.010262
pregnancy0.009908
crohn's disease0.009908
state of texas0.009908
2-year-old human stage0.009908
oral cavity0.009908
state of georgia0.009908
hispanic or latin american0.009908
russia0.009554
felis catus0.009554
diet0.009554
india0.009554
south africa0.009554
1-month-old human stage0.009554
homosexual0.009554
msm0.009554
no dental caries0.009554
adolescent stage0.009200
Number of experiments associating the term to the sequence
TermScore
feces382.000000
homo sapiens250.000000
adult158.000000
united states of america147.000000
control125.000000
LOWER IN control119.000000
research facility90.000000
china61.000000
mus musculus54.000000
saliva53.000000
female48.000000
mouse48.000000
child39.000000
male29.000000
infant28.000000
LOWER IN feces26.000000
canis lupus familiaris25.000000
captive24.000000
wild23.000000
dog22.000000
c57bl/617.000000
human adult stage16.000000
italy16.000000
monkey16.000000
farm16.000000
rural community15.000000
obesity14.000000
supragingival plaque14.000000
state of california13.000000
rat13.000000
zoological garden13.000000
diet12.000000
antibiotic12.000000
city12.000000
kingdom of spain12.000000
supragingival dental plaque12.000000
adult organism12.000000
ulcerative colitis11.000000
1-year-old human stage11.000000
crohn's disease11.000000
bird11.000000
canada11.000000
japan10.000000
dentition10.000000
c57bl/6j10.000000
high fat diet10.000000
australia10.000000
mouse chow10.000000
subgingival plaque10.000000
pregnancy9.000000
germany9.000000
commonwealth of pennsylvania9.000000
sus scrofa9.000000
pig9.000000
female organism9.000000
subgingival dental plaque9.000000
felis catus8.000000
equus caballus8.000000
israel8.000000
2-year-old human stage8.000000
rattus norvegicus8.000000
rumen8.000000
russia7.000000
india7.000000
united kingdom7.000000
south korea7.000000
sprague dawley7.000000
periodontitis7.000000
horse7.000000
thailand7.000000
2-5 year-old child stage7.000000
bos taurus7.000000
state of new york7.000000
ruminal fluid7.000000
mucus6.000000
obsolete_juvenile stage6.000000
sweden6.000000
state of texas6.000000
jackson laboratories6.000000
gorilla gorilla6.000000
macaca mulatta6.000000
cow6.000000
rectal swab6.000000
obese body mass index status5.000000
adolescent stage5.000000
1-month-old human stage5.000000
6-month-old human stage5.000000
french republic5.000000
homosexual5.000000
msm5.000000
nigeria5.000000
oral cavity5.000000
state of georgia5.000000
type 2 diabetes mellitus5.000000
amsterdam4.000000
south africa4.000000
chimpanzee4.000000
LOWER IN dental caries4.000000
dental caries4.000000
LOWER IN type 2 diabetes mellitus4.000000
village4.000000
kingdom of the netherlands4.000000
remission3.000000
LOWER IN remission3.000000
state of oklahoma3.000000
macaque3.000000
viet nam3.000000
third trimester3.000000
7-year-old human stage3.000000
milk3.000000
hispanic or latin american3.000000
6-year-old human stage3.000000
overweight body mass index status3.000000
dog food diet3.000000
18-month-old human stage3.000000
formula fed3.000000
4-year-old human stage3.000000
LOWER IN 4-year-old human stage3.000000
3-year-old human stage2.000000
glasgow2.000000
kenya2.000000
plant based diet2.000000
LOWER IN plant based diet2.000000
fire salamander2.000000
vervet monkey2.000000
serinus canaria2.000000
canary2.000000
anal swab2.000000
pan paniscus2.000000
bonobo2.000000
8-year-old human stage2.000000
rhesus macaque2.000000
vegetarian diet2.000000
LOWER IN vegetarian diet2.000000
wildlife sactuary2.000000
LOWER IN 18-month-old human stage2.000000
hangzhou city prefecture2.000000
LOWER IN hydrolized diet2.000000
hydrolized diet2.000000
forest musk deer2.000000
moschus berezovskii2.000000
auckland city2.000000
gambia2.000000
9-month-old human stage2.000000
no dental caries2.000000
marmosets2.000000
macaca nemestrina2.000000
daxin county1.000000
latvia1.000000
irkutsk1.000000
coral1.000000
ocean1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
interproximal dental plaque1.000000
lingual dental plaque1.000000
vestibular dental plaque1.000000
LOWER IN interproximal dental plaque1.000000
LOWER IN lingual dental plaque1.000000
orenburg1.000000
licosa island1.000000
podarcis siculus1.000000
lizard1.000000
punta licosa1.000000
LOWER IN punta licosa1.000000
LOWER IN licosa island1.000000
riwoqe county1.000000
age 4-7 years1.000000
kazakhstan1.000000
pig farm1.000000
chicken farm1.000000
LOWER IN chicken farm1.000000
LOWER IN pig farm1.000000
cardiovascular risk group1.000000
coats island1.000000
thick-billed murres1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
14amnonhighest in feces compared to colon ( high in feces compared to colon in mus musculus united states of america gastrointestinal system )2016-11-08v41 / 1approvedNo
23amnonhuman DNA (other homo sapiens, feces, united states of america)2016-11-29v41 / 1approvedNo
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v41 / 1approvedNo
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v41 / 1approvedNo
80amnonHigher in fruit season compared to leaf season ( high in season fruit season compared to leaf season in feces central america alouatta pigra howler monkey state of florida )2017-03-03v41 / 1approvedNo
121amnoncausitive agent for acute diarrhea (other pathogen, homo sapiens, feces, bangladesh, diarrhea)2017-04-13v41 / 1approvedNo
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v41 / 1approvedNo
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v41 / 1approvedNo
131amnonpositively correlated with age (30-80 years) ( high in human late adulthood stage age compared to fifth decade human stage fourth decade human stage in homo sapiens feces south korea )2017-04-16v41 / 1approvedNo
144amnon high in ancylostoma compared to control in canis lupus familiaris dog australia feces 2017-04-19v41 / 1approvedNo
158amnon high in pair of nares compared to saliva mouth in cat felis catus united states of america 2017-07-06v41 / 1approvedNo
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v41 / 1approvedNo
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in humanized mouse feces united states of america research facility )2018-04-29v41 / 1approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v41 / 1approvedNo
384amnon high in asthma compared to control in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v41 / 1approvedNo
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v41 / 1approvedNo
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 1approvedNo
434amnon high in control diet compared to fructose diet fructose in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v41 / 1approvedNo
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in plant fiber cell high fiber high arabinoxylan and resistant starch diet compared to control diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v41 / 1approvedNo
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v31 / 1approvedNo
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v31 / 1approvedNo
650amnonother asian, feces, seaweed degrading, bacteroides plebeius2020-09-12v41 / 1approvedNo
664amnoncausitive bacteria for ehrlichiosis (other blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog, ehrlichiosis, ehrlichia canis, pathogen)2020-09-22v41 / 1approvedNo
664amnondog blood mycoplasma (other mycoplasma haemocanis, blood, pathogen, semi domestic dog, bangkok, thailand, canis lupus familiaris, dog)2020-09-22v41 / 1approvedNo
664amnonanaplasmosis causing pathogen (other anaplasma platys, anaplasmosis, pathogen, blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog)2020-09-22v41 / 1approvedNo
666amnondominant rattus rattus, rat, italy, feces2020-09-25v31 / 1approvedNo
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v31 / 1approvedNo
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v41 / 1approvedNo
702amnon high in control compared to clostridium difficile infection in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v41 / 1approvedNo
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v31 / 1approvedNo
919amnon high in breast fed compared to formula fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 1approvedNo
978amnon high in feces compared to rectal swab in monkey callithrix jacchus marmosets captive research facility united states of america commonwealth of massachusetts boston 2022-12-24v41 / 1approvedNo
1010amnon high in abnormality of the intestine canine chronic enteropathy chronic enteropathy compared to control in feces dog canis lupus familiaris united states of america commonwealth of pennsylvania 2023-02-02v41 / 1approvedNo
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v41 / 2approvedNo
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 2approvedNo
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v41 / 2approvedNo
239amnon high in control compared to colorectal adenocarcinoma colorectal cancer carcinoma in homo sapiens feces united states of america 2017-11-08v41 / 2approvedNo
344amnon high in control compared to hiv infection in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v41 / 2approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v41 / 2approvedNo
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v41 / 2approvedNo
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v41 / 2approvedNo
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in canis lupus familiaris dog feces italy )2019-02-25v41 / 2approvedNo
455amnonColonizes gut as well as saliva (other homo sapiens, saliva, feces)2019-11-25v41 / 2approvedNo
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens russia adult 2020-01-05v31 / 2approvedNo
592amnondominant united states of america, feces, commonwealth of pennsylvania, wild, sheep, ovis aries2020-02-18v11 / 2approvedNo
664amnoncandidate contaminant in low biomass blood samples (contamination)2020-09-23v41 / 2approvedNo
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v31 / 2approvedNo
702amnondominant equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v41 / 2approvedNo
781amnondominant equus burchellii quagga, zebra, masai mara national park, kenya, wild, feces2021-04-28v41 / 2approvedNo
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v31 / 2approvedNo
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 2approvedNo
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v31 / 2approvedNo
877amnon high in low breath methane content compared to high breath methane content in human early adulthood stage adult homo sapiens feces austria 2022-03-08v41 / 2approvedNo
985amnon high in control compared to gingival bleeding in homo sapiens hong kong adult saliva oral rinse 2022-12-26v11 / 2approvedNo
1003amnon high in type 2 diabetes mellitus compared to control in hyderabad india homo sapiens feces 2022-12-31v31 / 2approvedNo
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v41 / 3approvedNo
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v41 / 3approvedNo
46amnonsmj: higher in female mice feces treated with antibiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v41 / 3approvedNo
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v41 / 3approvedNo
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v41 / 3approvedNo
80amnonHigher in leaf season compared to fruit season ( high in season leaf compared to botanical fruit food product in feces central america alouatta pigra howler monkey state of florida )2017-03-03v41 / 3approvedNo
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v41 / 3approvedNo
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v41 / 3approvedNo
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v41 / 3approvedNo
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v41 / 3approvedNo
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v41 / 3approvedNo
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in homo sapiens feces taiwan taipei city adult )2019-07-18v31 / 3approvedNo
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v31 / 3approvedNo
593amnon high in osteoarthritis compared to rheumatoid arthritis in homo sapiens feces adult south korea 2020-03-08v31 / 3approvedNo
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 3approvedNo
607amnon high in parkinson's disease rem sleep behavior disorder compared to control in germany homo sapiens feces 2020-04-19v41 / 3approvedNo
689amnon high in clostridium difficile infection clostridium difficile colitis compared to non c. diff diarrhea in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v41 / 3approvedNo
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v31 / 3approvedNo
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 3approvedNo
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v41 / 3approvedNo
833amnon high in athlete high exercise compared to normal exercise in homo sapiens feces age 60-65 years slovak republic adult 2021-09-11v11 / 3approvedNo
902amnondominant adult organism, horse, equus caballus, united states of america, control, feces2022-05-02v41 / 3approvedNo
919amnon high in formula fed compared to breast fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 3approvedNo
925amnon high in lingual dental plaque compared to interproximal dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v31 / 3approvedNo
966amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant gambia rural community homo sapiens feces 2022-12-21v31 / 3approvedNo
966amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens rural community gambia infant 2022-12-21v31 / 3approvedNo
966amnon high in severe malnutririon protein-energy malnutrition malnutrition compared to control in feces homo sapiens rural community gambia infant 1-year-old human stage 2022-12-21v31 / 3approvedNo
978amnon high in rectal swab compared to feces in boston commonwealth of massachusetts united states of america research facility captive marmosets callithrix jacchus monkey 2022-12-24v41 / 3approvedNo
1000amnon high in obese body mass index status obesity type 2 diabetes mellitus compared to control in feces homo sapiens viet nam adult female 2022-12-31v31 / 3approvedNo
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v41 / 4approvedNo
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v41 / 4approvedNo
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v41 / 4approvedNo
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v41 / 4approvedNo
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v41 / 4approvedNo
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v41 / 4approvedNo
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v41 / 4approvedNo
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v41 / 4approvedNo
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v41 / 4approvedNo
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v41 / 4approvedNo
440amnoncommon galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v41 / 4approvedNo
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v41 / 4approvedNo
570amnon high in visceral leishmaniasis compared to control in homo sapiens feces india bihar state 2019-12-16v31 / 4approvedNo
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v31 / 4approvedNo
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v31 / 4approvedNo
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v31 / 4approvedNo
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in germany homo sapiens feces 2020-04-19v41 / 4approvedNo
617amnon high in spring june compared to october autumn in lowland pasture lowland farm farm italy cow milk (raw) cow milk (fluid) milk 2020-05-03v31 / 4approvedNo
655amnon high in before hsct compared to hematopoietic stem cell transplant after hcst in italy feces homo sapiens 2020-09-13v31 / 4approvedNo
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v41 / 4approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 4approvedNo
850amnoncommon sperm, semen, male organism, in vitro fertilization clinic, anambra state, nigeria, adult, homo sapiens2021-12-16v41 / 4approvedNo
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v41 / 4approvedNo
931amnondominant riwoqe county, china, ruminal fluid, yak, tibet autonomous region, bos grunniens, rumen2022-08-25v31 / 4approvedNo
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v41 / 5approvedNo
88amnonhigher in younger cape buffalo feces ( high in age young age compared to old age in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 5approvedNo
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in homo sapiens feces united states of america )2017-10-23v41 / 5approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v41 / 5approvedNo
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 5approvedNo
418amnoncommon coral, favites abdita, mucus, ocean2018-12-02v41 / 5approvedNo
440amnoncommon galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v41 / 5approvedNo
448amnonhigh freq. in healthy horse feces (dominant equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v41 / 5approvedNo
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v31 / 5approvedNo
550amnondominant city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v41 / 5approvedNo
550amnon high in starfish wild coelomic fluid asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v41 / 5approvedNo
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v31 / 5approvedNo
598amnon high in male compared to female in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v31 / 5approvedNo
598amnon high in female compared to male in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v31 / 5approvedNo
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 5approvedNo
666amnondominant cow, bos taurus, italy, feces2020-09-25v31 / 5approvedNo
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v41 / 5approvedNo
794amnon high in antiretroviral therapy human immunodeficiency virus infectious disease hiv infection compared to control in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v41 / 5approvedNo
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 5approvedNo
831amnon high in control compared to pancreatic cancer in israel adult feces homo sapiens 2021-09-11v31 / 5approvedNo
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v31 / 5approvedNo
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 5approvedNo
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 5approvedNo
925amnon high in interproximal dental plaque compared to lingual dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v31 / 5approvedNo
950amnondominant bird, uria lomvia, thick-billed murres, canada, coats island, feces, cloacal swab2022-12-07v41 / 5approvedNo
26amnon high in inguinal region axilla compared to pair of nares mucus in united states of america homo sapiens 2016-12-05v41 / 6approvedNo
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v41 / 6approvedNo
63amnon high in diet plant based diet compared to animal product diet in homo sapiens united states of america feces 2017-04-12v41 / 6approvedNo
231amnonhigh freq. in dog urine (dominant dog, canis lupus familiaris, united states of america, urine)2017-11-02v41 / 6approvedNo
239amnon high in colorectal adenocarcinoma colorectal cancer carcinoma compared to control in homo sapiens feces united states of america 2017-11-08v41 / 6approvedNo
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v41 / 6approvedNo
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v41 / 6approvedNo
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 6approvedNo
344amnon high in hiv infection compared to control in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v41 / 6approvedNo
384amnon high in control compared to asthma in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v41 / 6approvedNo
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in homo sapiens feces thailand adult )2018-11-18v41 / 6approvedNo
418amnondominant coral, favites abdita, mucus, ocean2018-12-02v41 / 6approvedNo
440amnoncommon galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v41 / 6approvedNo
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v41 / 6approvedNo
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v41 / 6approvedNo
550amnondominant city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v41 / 6approvedNo
592amnondominant feces, united states of america, bos taurus, cow, farm, commonwealth of pennsylvania2020-02-18v11 / 6approvedNo
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 6approvedNo
664amnondominant blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v41 / 6approvedNo
702amnon high in clostridium difficile infection compared to control in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v41 / 6approvedNo
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v31 / 6approvedNo
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v31 / 6approvedNo
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v41 / 6approvedNo
919amnondominant 2-month-old human stage, 1-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 6approvedNo
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, ileum, colon, caecum, feces2022-08-25v31 / 6approvedNo
966amnon high in control compared to protein-energy malnutrition severe malnutririon malnutrition in 1-year-old human stage infant gambia rural community homo sapiens feces 2022-12-21v31 / 6approvedNo
985amnon high in dentures compared to control in oral rinse saliva adult hong kong homo sapiens 2022-12-26v11 / 6approvedNo
985amnon high in gingival bleeding compared to control in oral rinse saliva adult hong kong homo sapiens 2022-12-26v11 / 6approvedNo
1000amnon high in control compared to obese body mass index status obesity type 2 diabetes mellitus in female adult viet nam homo sapiens feces 2022-12-31v31 / 6approvedNo
1010amnon high in antibiotic compared to no antimicrobial treatment in feces dog canis lupus familiaris united states of america commonwealth of pennsylvania abnormality of the intestine chronic enteropathy canine chronic enteropathy 2023-02-02v41 / 6approvedNo
1021amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in obese body mass index status obesity adolescent stage irkutsk russia feces homo sapiens 2023-04-06v31 / 7approvedNo
18amnondominant feces, united states of america, equus caballus2016-11-09v41 / 7approvedNo
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v41 / 7approvedNo
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v41 / 7approvedNo
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v41 / 7approvedNo
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v41 / 7approvedNo
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v41 / 7approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v41 / 7approvedNo
406amnondominant feces, zoological garden, french republic, equus zebra, mountain zebra2018-11-21v41 / 7approvedNo
406amnondominant feces, south africa, antidorcas marsupialis, springbok2018-11-21v41 / 7approvedNo
406amnondominant feces, south africa, aepyceros melampus, impala2018-11-21v41 / 7approvedNo
418amnoncommon coral, ocean, porites lobata, mucus2018-12-02v41 / 7approvedNo
418amnondominant coral, ocean, isopora palifera, mucus2018-12-02v41 / 7approvedNo
418amnondominant coral, ocean, turbinaria reniformis, mucus2018-12-02v41 / 7approvedNo
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v41 / 7approvedNo
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v41 / 7approvedNo
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v41 / 7approvedNo
454amnondominant feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v41 / 7approvedNo
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v31 / 7approvedNo
550amnon high in asterias amurensis compared to patiria pectinifera in city hokkaido starfish coelomic fluid wild japan 2019-08-18v41 / 7approvedNo
644amnonpositively correalted with bmi ( high in high bmi body mass index compared to low bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 7approvedNo
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 7approvedNo
666amnondominant sheep, ovis aries, italy, feces2020-09-25v31 / 7approvedNo
666amnondominant alpaca, vicugna pacos, italy, feces2020-09-25v31 / 7approvedNo
679amnondominant saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v31 / 7approvedNo
730amnon high in crohn's disease compared to control in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v11 / 7approvedNo
734amnon high in vegetarian diet compared to omnivore diet in republic of china taiwan adult feces homo sapiens 2021-01-22v31 / 7approvedNo
781amnondominant cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v41 / 7approvedNo
806amnon high in oral wash oral cavity compared to saliva in homo sapiens adult state of new york united states of america 2021-06-19v31 / 7approvedNo
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v31 / 7approvedNo
833amnon high in normal exercise compared to athlete high exercise in adult slovak republic age 60-65 years feces homo sapiens 2021-09-11v11 / 7approvedNo
841amnon high in iga negative fraction compared to iga positive fraction in human adult stage state of texas adult saliva united states of america homo sapiens 2021-11-08v41 / 7approvedNo
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v41 / 7approvedNo
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 7approvedNo
892amnon high in 4-year-old human stage compared to 2-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v41 / 7approvedNo
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 7approvedNo
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v31 / 7approvedNo
985amnon high in control compared to dentures in homo sapiens hong kong adult saliva oral rinse 2022-12-26v11 / 7approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, state of texas, houston, gorilla gorilla2022-12-27v41 / 7approvedNo
1010amnon high in dog food diet compared to hydrolized diet in commonwealth of pennsylvania united states of america canis lupus familiaris dog feces 2023-02-02v41 / 7approvedNo
17amnondominant ochotona, feces, stomach, tibetan plateau2016-11-09v41 / 8approvedNo
28amnondominant hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v41 / 8approvedNo
88amnondominant syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v41 / 8approvedNo
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v41 / 8approvedNo
274amnondominant monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v41 / 8approvedNo
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v41 / 8approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v41 / 8approvedNo
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v41 / 8approvedNo
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 8approvedNo
406amnondominant feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v41 / 8approvedNo
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v41 / 8approvedNo
406amnondominant feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v41 / 8approvedNo
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v41 / 8approvedNo
417amnondominant anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v41 / 8approvedNo
418amnoncommon coral, ocean, pocillopora damicornis, mucus2018-12-02v41 / 8approvedNo
418amnondominant coral, ocean, porites lobata, mucus2018-12-02v41 / 8approvedNo
418amnoncommon coral, ocean, diploastrea heliopora, mucus2018-12-02v41 / 8approvedNo
418amnondominant coral, ocean, physogyra lichtensteini, mucus2018-12-02v41 / 8approvedNo
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v41 / 8approvedNo
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v41 / 8approvedNo
440amnondominant galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v41 / 8approvedNo
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v41 / 8approvedNo
454amnondominant feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v41 / 8approvedNo
515amnondominant whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v41 / 8approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v41 / 8approvedNo
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v41 / 8approvedNo
518amnondominant bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v41 / 8approvedNo
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v31 / 8approvedNo
592amnondominant united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v11 / 8approvedNo
594amnondominant adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v41 / 8approvedNo
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v41 / 8approvedNo
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 8approvedNo
666amnoncommon european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v31 / 8approvedNo
666amnondominant mouflon, ovis aries musimon, italy, feces2020-09-25v31 / 8approvedNo
702amnon high in dog canis lupus familiaris compared to cat felis catus in state of north carolina united states of america feces 2028-04-02v41 / 8approvedNo
777amnondominant 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 8approvedNo
859amnon high in 1-month-old human stage compared to 6-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 8approvedNo
889amnondominant reindeer, rangifer tarandus, ruminal fluid, siberia, russia, rumen2022-04-01v31 / 8approvedNo
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 8approvedNo
906amnon high in male organism compared to female organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v41 / 8approvedNo
940amnondominant feces, rectal swab, rectum, bos taurus, farm, kazakhstan, cow2022-11-25v31 / 8approvedNo
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
960amnoncommon meconium, newborn human stage, infant, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v41 / 9approvedNo
80amnondominant feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v41 / 9approvedNo
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v41 / 9approvedNo
308amnondominant red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v41 / 9approvedNo
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 9approvedNo
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v41 / 9approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v41 / 9approvedNo
406amnondominant feces, zoological garden, french republic, equus hemionus, onager2018-11-21v41 / 9approvedNo
406amnondominant feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v41 / 9approvedNo
466amnondominant feces, bos taurus, cow, farm, united states of america, state of georgia2019-01-14v41 / 9approvedNo
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v41 / 9approvedNo
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v41 / 9approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v41 / 9approvedNo
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v31 / 9approvedNo
559amnondominant feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v41 / 9approvedNo
626amnoncommon red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v11 / 9approvedNo
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in amsterdam kingdom of the netherlands adult homosexual msm feces homo sapiens 2020-05-31v41 / 9approvedNo
630amnon high in high physical activity compared to sedentary low physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v31 / 9approvedNo
645amnon high in feces compared to cloaca in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v41 / 9approvedNo
658amnon high in european caucasian compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 9approvedNo
658amnon high in caucasian european compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v31 / 9approvedNo
666amnondominant goat, capra hircus, italy, feces2020-09-25v31 / 9approvedNo
678amnon high in tooth disease black dental staining compared to control in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v31 / 9approvedNo
693amnon high in control compared to polycystic ovary syndrome in graz city district austria adult feces homo sapiens female 2028-03-16v11 / 9approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v31 / 9approvedNo
742amnondominant dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v31 / 9approvedNo
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v41 / 9approvedNo
781amnondominant eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v41 / 9approvedNo
781amnondominant impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v41 / 9approvedNo
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 9approvedNo
847amnon high in 25-44 year-old human stage compared to 80 year-old and over human stage ninth decade human stage in japan feces 2021-12-01v11 / 9approvedNo
863amnondominant forest musk deer, moschus berezovskii, qilian county, china, deer, captive, farm, feces2022-01-28v41 / 9approvedNo
864amnondominant ocotal state park, mexican wolf, raw meat diet, canis lupus baileyi, municipality of timilpan, captive, mexico, feces2022-02-08v31 / 9approvedNo
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 9approvedNo
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in province of alberta canada adult homo sapiens feces )2022-02-12v41 / 9approvedNo
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v31 / 9approvedNo
888amnondominant bulk tank milk, cow milk (raw), ireland, milk2022-03-30v31 / 9approvedNo
906amnondominant grey squirrel, sciurus carolinensis, province of ontario, canada, feces2022-05-19v41 / 9approvedNo
998amnon high in non-surgical periodontal therapy compared to before therapy in periodontitis united kingdom glasgow adult subgingival plaque subgingival dental plaque homo sapiens 2022-12-30v31 / 9approvedNo
1003amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens india hyderabad 2022-12-31v31 / 9approvedNo
1006amnondominant feces, monkey, captive, united states of america, state of maryland, research facility, bethesda, macaca mulatta, rhesus macaque2023-01-09v41 / 9approvedNo
1010amnon high in hydrolized diet compared to dog food diet in feces dog canis lupus familiaris united states of america commonwealth of pennsylvania 2023-02-02v41 / 9approvedNo
1019amnoncommon latvia, under-1-year-old human stage, infant, feces, homo sapiens2023-04-03v31 / 10approvedNo
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v41 / 10approvedNo
26amnondominant canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v41 / 10approvedNo
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v41 / 10approvedNo
78amnondominant nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v41 / 10approvedNo
99amnondominant commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v41 / 10approvedNo
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v41 / 10approvedNo
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 10approvedNo
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 10approvedNo
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v41 / 10approvedNo
406amnondominant feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v41 / 10approvedNo
411amnondominant zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v41 / 10approvedNo
417amnondominant anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v41 / 10approvedNo
418amnoncommon coral, ocean, acropora hyacinthus, mucus2018-12-02v41 / 10approvedNo
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v41 / 10approvedNo
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v31 / 10approvedNo
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v41 / 10approvedNo
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v31 / 10approvedNo
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v31 / 10approvedNo
559amnondominant feces, united states of america, captive, zoological garden, ceratotherium simum, white rhinoceros2019-11-03v41 / 10approvedNo
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v41 / 10approvedNo
632amnondominant feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v41 / 10approvedNo
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 10approvedNo
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v31 / 10approvedNo
666amnondominant horse, equus caballus, italy, feces2020-09-25v31 / 10approvedNo
781amnondominant tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v41 / 10approvedNo
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 10approvedNo
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v31 / 10approvedNo
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in japan feces 2021-12-01v11 / 10approvedNo
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 10approvedNo
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in canada province of alberta adult feces homo sapiens )2022-02-12v41 / 10approvedNo
890amnoncommon pacific ocean, mikura-jima, japan, wild, feces, bottlenosed dolphin, tursiops truncatus2022-04-03v31 / 10approvedNo
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, research facility, feces2022-05-18v31 / 10approvedNo
919amnoncommon saliva, 2-month-old human stage, 1-month-old human stage, infant, state of victoria, australia, homo sapiens2022-07-17v41 / 10approvedNo
982amnondominant forest musk deer, moschus berezovskii, feces, captive, mongolia, china2022-12-25v31 / 10approvedNo
983amnon high in supragingival plaque supragingival dental plaque compared to saliva in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 10approvedNo
992amnondominant saccostrea glomerata, sydney rock oyster, hemolymph, australia, temp 24c, research facility, port stephens council2022-12-27v31 / 10approvedNo
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v41 / 11approvedNo
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v41 / 11approvedNo
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v41 / 11approvedNo
99amnondominant commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v41 / 11approvedNo
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 11approvedNo
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v41 / 11approvedNo
302amnonhigh freq. in feces of canary pet birds (dominant bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v41 / 11approvedNo
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v41 / 11approvedNo
371amnondominant feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v41 / 11approvedNo
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 11approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v41 / 11approvedNo
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v41 / 11approvedNo
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v41 / 11approvedNo
418amnondominant coral, ocean, galaxea astreata, mucus2018-12-02v41 / 11approvedNo
418amnondominant coral, ocean, pocillopora damicornis, mucus2018-12-02v41 / 11approvedNo
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 11approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v41 / 11approvedNo
592amnondominant wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v11 / 11approvedNo
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to teeth braces braces in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 11approvedNo
617amnondominant lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v31 / 11approvedNo
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v41 / 11approvedNo
633amnondominant feces, elephas maximus, asian elephant, captive, thailand2020-06-16v41 / 11approvedNo
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 11approvedNo
664amnoncommon blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v41 / 11approvedNo
702amnondominant state of north carolina, united states of america, feces, sheep, ovis aries2028-04-02v41 / 11approvedNo
729amnondominant europe, zoological garden, feces, monkey, gorilla gorilla2021-01-05v31 / 11approvedNo
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v31 / 11approvedNo
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v31 / 11approvedNo
781amnondominant cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v41 / 11approvedNo
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v31 / 11approvedNo
848amnoncommon 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 11approvedNo
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v31 / 11approvedNo
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v31 / 11approvedNo
863amnondominant xinglong mountain national nature reserve, alpine musk deer, moschus chrysogaster, yuzhong county, china, deer, captive, farm, feces2022-01-28v41 / 11approvedNo
898amnon high in jejunum duodenum compared to descending colon ascending colon feces in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v41 / 11approvedNo
919amnondominant state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 11approvedNo
977amnondominant in raw milk used for cheese production (dominant minas gerais state, brazil, milk, raw milk)2022-12-24v41 / 11approvedNo
26amnondominant united states of america, felis catus, mucus, pair of nares2016-12-05v41 / 12approvedNo
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v41 / 12approvedNo
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v41 / 12approvedNo
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v41 / 12approvedNo
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v41 / 12approvedNo
137amnondominant gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v41 / 12approvedNo
161amnonhigh freq. in barn swallows in colorado (dominant state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v41 / 12approvedNo
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v41 / 12approvedNo
308amnondominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v41 / 12approvedNo
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v41 / 12approvedNo
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v41 / 12approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v41 / 12approvedNo
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v41 / 12approvedNo
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v41 / 12approvedNo
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v41 / 12approvedNo
418amnondominant coral, ocean, fungia, mucus2018-12-02v41 / 12approvedNo
418amnondominant coral, ocean, porites cylindrica, mucus2018-12-02v41 / 12approvedNo
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v41 / 12approvedNo
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v41 / 12approvedNo
440amnondominant galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v41 / 12approvedNo
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v41 / 12approvedNo
556amnondominant homo sapiens, feces, united states of america, adult2019-09-14v11 / 12approvedNo
559amnondominant feces, united states of america, captive, zoological garden, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v41 / 12approvedNo
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v31 / 12approvedNo
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v41 / 12approvedNo
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v11 / 12approvedNo
592amnondominant wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v11 / 12approvedNo
596amnondominant 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 12approvedNo
645amnondominant feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v41 / 12approvedNo
666amnondominant italy, feces, wild horse, equus ferus2020-09-25v31 / 12approvedNo
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 12approvedNo
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 12approvedNo
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 12approvedNo
777amnondominant 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 12approvedNo
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v31 / 12approvedNo
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 12approvedNo
797amnoncommon breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 12approvedNo
806amnon high in saliva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v31 / 12approvedNo
815amnon high in red fox vulpes vulpes compared to corsac fox vulpes corsac in lake hulun wild winter mongolia feces 2021-07-04v31 / 12approvedNo
847amnondominant 80 year-old and over human stage, ninth decade human stage, japan, feces2021-12-01v11 / 12approvedNo
873amnondominant urban community, human adult stage, commonwealth of pennsylvania, adult, united states of america, homo sapiens, feces2022-03-03v11 / 12approvedNo
906amnon high in female organism compared to male organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v41 / 12approvedNo
914amnondominant yak, qinghai province, tibet autonomous region, bos grunniens, feces2022-06-26v31 / 12approvedNo
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v31 / 12approvedNo
935amnondominant monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v41 / 12approvedNo
941amnondominant homo sapiens, feces, thailand, farm, adult, nan province, village, rural community, chicken farm2022-11-25v41 / 12approvedNo
967amnondominant feces, wild, assamese macaque, monkey, macaca assamensis, phu khieo wildlife sanctuary, wildlife sactuary, thailand, adult organism, female organism2022-12-23v31 / 12approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, state of ohio, columbus, pongo sp., orangutan2022-12-27v41 / 12approvedNo
1006amnondominant feces, monkey, chlorocebus pygerythrus, vervet monkey, captive, united states of america, state of maryland, research facility, bethesda2023-01-08v41 / 12approvedNo
1020amnon high in remission ulcerative colitis compared to control in human adult stage adult japan feces homo sapiens 2023-04-06v31 / 13approvedNo
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v41 / 13approvedNo
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v41 / 13approvedNo
187amnondominant rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v41 / 13approvedNo
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v41 / 13approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v41 / 13approvedNo
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v41 / 13approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v41 / 13approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v41 / 13approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v41 / 13approvedNo
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v41 / 13approvedNo
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v41 / 13approvedNo
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v41 / 13approvedNo
418amnondominant coral, ocean, stylophora pistillata, mucus2018-12-02v41 / 13approvedNo
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v41 / 13approvedNo
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v41 / 13approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v41 / 13approvedNo
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v41 / 13approvedNo
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v31 / 13approvedNo
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v41 / 13approvedNo
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v31 / 13approvedNo
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v31 / 13approvedNo
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v41 / 13approvedNo
620amnondominant village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 13approvedNo
625amnondominant gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v41 / 13approvedNo
642amnondominant san diego, pacific ocean, chub mackerel, scomber japonicus, feces, digesta, fish2020-08-28v41 / 13approvedNo
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v41 / 13approvedNo
666amnondominant short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v31 / 13approvedNo
666amnondominant pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v31 / 13approvedNo
666amnondominant tiger, panthera tigris, italy, feces2020-09-25v31 / 13approvedNo
666amnondominant common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v31 / 13approvedNo
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 13approvedNo
713amnon high in remission compared to active disease in crohn's disease feces homo sapiens 2028-05-21v31 / 13approvedNo
748amnondominant jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v41 / 13approvedNo
748amnondominant holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v41 / 13approvedNo
781amnondominant thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v41 / 13approvedNo
788amnondominant cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v41 / 13approvedNo
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 13approvedNo
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v31 / 13approvedNo
833amnondominant high exercise, athlete, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v11 / 13approvedNo
847amnondominant centenarian human stage, eleventh decade human stage, japan, feces2021-12-01v11 / 13approvedNo
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
861amnondominant urban community, soweto, rural community, south africa, city, female, homo sapiens, feces2022-01-15v31 / 13approvedNo
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 13approvedNo
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v41 / 13approvedNo
890amnondominant mikura-jima, japan, wild, bottlenosed dolphin, pacific ocean, tursiops truncatus, feces2022-04-03v31 / 13approvedNo
902amnondominant salmonellosis, adult organism, horse, equus caballus, salmonella gastroenteritis, antibiotic, united states of america, feces2022-05-02v41 / 13approvedNo
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v31 / 13approvedNo
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 13approvedNo
982amnondominant feces, captive, mongolia, china, moschus moschiferus, siberian musk deer, ulan bator2022-12-25v31 / 13approvedNo
992amnondominant saccostrea glomerata, sydney rock oyster, hemolymph, australia, research facility, port stephens council, temp 28c2022-12-27v31 / 13approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, state of texas, houston, pan troglodytes, chimpanzee2022-12-27v41 / 13approvedNo
1006amnondominant feces, monkey, captive, united states of america, state of maryland, research facility, bethesda, macaca nemestrina, pig tailed macaque monkey2023-01-08v41 / 13approvedNo
1010amnon high in control compared to canine chronic enteropathy abnormality of the intestine chronic enteropathy in commonwealth of pennsylvania united states of america canis lupus familiaris dog feces 2023-02-02v41 / 13approvedNo
1010amnon high in no antimicrobial treatment compared to antibiotic in canine chronic enteropathy chronic enteropathy abnormality of the intestine commonwealth of pennsylvania united states of america canis lupus familiaris dog feces 2023-02-02v41 / 13approvedNo
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v41 / 14approvedNo
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v41 / 14approvedNo
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v41 / 14approvedNo
80amnondominant feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v41 / 14approvedNo
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 14approvedNo
190amnondominant homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v41 / 14approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v41 / 14approvedNo
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v41 / 14approvedNo
231amnonlower in urine compared to genitalia in dogs ( high in reproductive system reproductive organ compared to urine in dog canis lupus familiaris united states of america )2017-11-02v41 / 14approvedNo
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v41 / 14approvedNo
302amnonhigh freq. in feces of Cockatiel pet birds (dominant bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v41 / 14approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v41 / 14approvedNo
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v41 / 14approvedNo
399amnondominant feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v41 / 14approvedNo
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v41 / 14approvedNo
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v41 / 14approvedNo
406amnondominant feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v41 / 14approvedNo
406amnondominant feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v41 / 14approvedNo
418amnondominant coral, ocean, symphyllia, mucus2018-12-02v41 / 14approvedNo
418amnondominant coral, ocean, diploastrea heliopora, mucus2018-12-02v41 / 14approvedNo
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v41 / 14approvedNo
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v41 / 14approvedNo
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v41 / 14approvedNo
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v41 / 14approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v41 / 14approvedNo
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v41 / 14approvedNo
546amnondominant homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v31 / 14approvedNo
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v31 / 14approvedNo
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 14approvedNo
596amnondominant 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 14approvedNo
596amnondominant 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 14approvedNo
617amnon high in october autumn compared to spring june in lowland pasture lowland farm farm italy cow milk (raw) cow milk (fluid) milk 2020-05-03v31 / 14approvedNo
625amnondominant son tra nature reserve, viet nam, pygathrix nemaeus, red-shanked douc, wild, feces2020-05-16v41 / 14approvedNo
626amnoncommon strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v11 / 14approvedNo
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 14approvedNo
648amnon high in antibiotic metronidazole compared to control in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v41 / 14approvedNo
666amnondominant italy, feces, wood mouse, apodemus sylvaticus2020-09-25v31 / 14approvedNo
666amnondominant equus asinus africanus, african wild ass, feces, italy2020-09-25v31 / 14approvedNo
666amnondominant rattus rattus, rat, italy, feces2020-09-25v31 / 14approvedNo
693amnondominant graz city district, austria, adult, feces, homo sapiens, female2028-03-16v11 / 14approvedNo
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v41 / 14approvedNo
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v31 / 14approvedNo
734amnon high in omnivore diet compared to vegetarian diet in republic of china taiwan adult feces homo sapiens 2021-01-22v31 / 14approvedNo
748amnondominant jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v41 / 14approvedNo
759amnondominant state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v41 / 14approvedNo
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 14approvedNo
781amnondominant giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v41 / 14approvedNo
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 14approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 14approvedNo
797amnondominant breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v31 / 14approvedNo
812amnondominant zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v31 / 14approvedNo
831amnondominant israel, adult, feces, homo sapiens, pancreatic cancer2021-09-11v31 / 14approvedNo
834amnondominant homo sapiens, feces, japan, adult2021-09-11v11 / 14approvedNo
862amnondominant himalayan griffon, gyps himalayensis, china, qinghai province, bird, feces2022-01-20v41 / 14approvedNo
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in china feces 2022-02-08v31 / 14approvedNo
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v11 / 14approvedNo
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v41 / 14approvedNo
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 14approvedNo
888amnondominant milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v31 / 14approvedNo
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 14approvedNo
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 14approvedNo
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 14approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v41 / 14approvedNo
962amnondominant mouse, mus musculus, research facility, feces, united states of america, female organism, c57bl/6, state of rhode island2022-12-20v41 / 14approvedNo
974amnondominant anal swab, zoological garden, captive, brazil, feces, marmosets, callithrix <genus>, monkey2022-12-24v41 / 14approvedNo
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v41 / 15approvedNo
51amnondominant feces, homo sapiens, united states of america2017-01-19v41 / 15approvedNo
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v41 / 15approvedNo
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v41 / 15approvedNo
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v41 / 15approvedNo
74amnondominant united states of america, feces, homo sapiens2017-02-27v41 / 15approvedNo
75amnondominant homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v41 / 15approvedNo
99amnondominant commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v41 / 15approvedNo
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v41 / 15approvedNo
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 15approvedNo
276amnondominant feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v41 / 15approvedNo
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v41 / 15approvedNo
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 15approvedNo
358amnondominant rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v41 / 15approvedNo
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v41 / 15approvedNo
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v41 / 15approvedNo
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v41 / 15approvedNo
380amnondominant tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v41 / 15approvedNo
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v41 / 15approvedNo
384amnondominant equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v41 / 15approvedNo
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v41 / 15approvedNo
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v41 / 15approvedNo
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 15approvedNo
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 15approvedNo
406amnondominant feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v41 / 15approvedNo
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v41 / 15approvedNo
418amnondominant coral, ocean, pavona varians, mucus2018-12-02v41 / 15approvedNo
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v41 / 15approvedNo
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v41 / 15approvedNo
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v41 / 15approvedNo
440amnondominant galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v41 / 15approvedNo
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v41 / 15approvedNo
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v41 / 15approvedNo
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v41 / 15approvedNo
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v41 / 15approvedNo
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v41 / 15approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v41 / 15approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v41 / 15approvedNo
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v41 / 15approvedNo
517amnondominant feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v41 / 15approvedNo
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v41 / 15approvedNo
550amnoncommon city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v41 / 15approvedNo
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v41 / 15approvedNo
559amnondominant feces, united states of america, captive, zoological garden, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v41 / 15approvedNo
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v31 / 15approvedNo
570amnondominant homo sapiens, feces, india, bihar state2019-12-16v31 / 15approvedNo
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v41 / 15approvedNo
592amnoncommon feces, wild, state of florida, carcharhinus leucas, bull shark2020-02-18v11 / 15approvedNo
592amnondominant feces, wild, state of florida, carcharhinus leucas, bull shark2020-02-18v11 / 15approvedNo
596amnondominant 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 15approvedNo
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 15approvedNo
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v41 / 15approvedNo
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 15approvedNo
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 15approvedNo
655amnon high in hematopoietic stem cell transplant after hcst compared to before hsct in italy feces homo sapiens 2020-09-13v31 / 15approvedNo
658amnon high in african american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 15approvedNo
658amnon high in hispanic hispanic or latin american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 15approvedNo
666amnondominant donkey, equus asinus, equus asinus africanus, feces, italy2020-09-25v31 / 15approvedNo
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 15approvedNo
702amnoncommon canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v41 / 15approvedNo
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v31 / 15approvedNo
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v41 / 15approvedNo
729amnondominant cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v31 / 15approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v31 / 15approvedNo
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v41 / 15approvedNo
777amnoncommon 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 15approvedNo
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v41 / 15approvedNo
781amnondominant kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v41 / 15approvedNo
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v31 / 15approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
802amnondominant cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v41 / 15approvedNo
805amnondominant sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v31 / 15approvedNo
806amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v31 / 15approvedNo
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in lake hulun wild winter mongolia feces 2021-07-04v31 / 15approvedNo
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 15approvedNo
846amnondominant stimulated saliva, human adult stage, commonwealth of massachusetts, adult, saliva, united states of america, homo sapiens2021-11-20v31 / 15approvedNo
847amnondominant human early adulthood stage, japan, feces2021-12-01v11 / 15approvedNo
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v41 / 15approvedNo
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 15approvedNo
888amnondominant skimmed milk powder, milk powder, cow milk based food product, ireland, milk2022-03-30v31 / 15approvedNo
892amnon high in 2-year-old human stage compared to 4-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v41 / 15approvedNo
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 15approvedNo
925amnondominant vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v31 / 15approvedNo
926amnondominant 2-5 year-old child stage, orenburg, supragingival dental plaque, supragingival plaque, russia, child, homo sapiens2022-07-28v31 / 15approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v41 / 15approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, supragingival plaque, supragingival dental plaque2022-12-26v31 / 15approvedNo
983amnon high in tonsil surface tonsil compared to saliva in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 15approvedNo
984amnondominant wild, state of california, united states of america, enhydra lutris nereis, sea otter, feces2022-12-26v41 / 15approvedNo
986amnondominant feces, new zealand, bird, porphyrio hochstetteri, takahe2022-12-26v31 / 15approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, gorilla gorilla, state of ohio, columbus, captive2022-12-27v41 / 15approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, no iron deficiency anemia2022-12-30v31 / 15approvedNo
15amnondominant namibia, feces, canis mesomelas2016-11-08v41 / 16approvedNo
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v41 / 16approvedNo
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v41 / 16approvedNo
49amnondominant giraffa camelopardalis, feces2017-01-19v41 / 16approvedNo
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v41 / 16approvedNo
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v41 / 16approvedNo
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v41 / 16approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v41 / 16approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 16approvedNo
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v41 / 16approvedNo
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v41 / 16approvedNo
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v41 / 16approvedNo
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v41 / 16approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v41 / 16approvedNo
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v41 / 16approvedNo
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v41 / 16approvedNo
399amnondominant pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v41 / 16approvedNo
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v41 / 16approvedNo
411amnondominant zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v41 / 16approvedNo
427amnondominant united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v41 / 16approvedNo
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v41 / 16approvedNo
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v41 / 16approvedNo
448amnondominant equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v41 / 16approvedNo
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v41 / 16approvedNo
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v41 / 16approvedNo
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v31 / 16approvedNo
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v31 / 16approvedNo
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v11 / 16approvedNo
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v41 / 16approvedNo
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v31 / 16approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v41 / 16approvedNo
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v41 / 16approvedNo
592amnondominant feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v11 / 16approvedNo
598amnondominant 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v31 / 16approvedNo
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v41 / 16approvedNo
625amnondominant feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v41 / 16approvedNo
625amnondominant pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v41 / 16approvedNo
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v31 / 16approvedNo
656amnondominant child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v31 / 16approvedNo
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v41 / 16approvedNo
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v41 / 16approvedNo
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v31 / 16approvedNo
678amnondominant control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v31 / 16approvedNo
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v31 / 16approvedNo
683amnondominant during antibiotics treatment in feces (dominant metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v41 / 16approvedNo
713amnon high in active disease compared to remission in crohn's disease feces homo sapiens 2028-05-21v31 / 16approvedNo
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v31 / 16approvedNo
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v31 / 16approvedNo
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v31 / 16approvedNo
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v41 / 16approvedNo
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v41 / 16approvedNo
781amnondominant elephant, loxodonta africana, masai mara national park, kenya, wild, feces2021-04-28v41 / 16approvedNo
794amnondominant control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v41 / 16approvedNo
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v41 / 16approvedNo
872amnondominant age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v11 / 16approvedNo
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 16approvedNo
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v41 / 16approvedNo
892amnondominant 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 16approvedNo
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v41 / 16approvedNo
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v31 / 16approvedNo
922amnondominant no dental caries, 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-07-25v41 / 16approvedNo
927amnondominant licosa island, lizard, podarcis siculus, italy, feces2022-08-15v31 / 16approvedNo
941amnondominant homo sapiens, feces, thailand, farm, pig farm, adult, nan province, village, rural community2022-11-25v41 / 16approvedNo
943amnonhigher before 6 day plant based diet ( high in normal diet compared to vegetarian diet plant based diet in cardiovascular risk group state of florida united states of america adult feces homo sapiens )2022-11-25v31 / 16approvedNo
974amnon high in captive zoological garden compared to wild in anal swab brazil feces marmosets callithrix <genus> monkey 2022-12-24v41 / 16approvedNo
980amnon high in control compared to mental depression in homo sapiens feces china hangzhou city prefecture 2022-12-25v31 / 16approvedNo
1012amnondominant apis mellifera, honeybee, honey, beehive, england, apiary2023-03-09v11 / 16approvedNo
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v41 / 17approvedNo
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v41 / 17approvedNo
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v41 / 17approvedNo
65amnondominant lytechinus variegatus, feces, digesta, state of florida2017-02-17v41 / 17approvedNo
71amnondominant liolaemus ruibali, argentina, research facility, feces2017-02-25v41 / 17approvedNo
208amnondominant mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v41 / 17approvedNo
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v41 / 17approvedNo
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v41 / 17approvedNo
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v41 / 17approvedNo
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v41 / 17approvedNo
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v41 / 17approvedNo
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v41 / 17approvedNo
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 17approvedNo
351amnondominant sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v41 / 17approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v41 / 17approvedNo
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v41 / 17approvedNo
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v41 / 17approvedNo
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v41 / 17approvedNo
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v41 / 17approvedNo
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v41 / 17approvedNo
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v41 / 17approvedNo
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v41 / 17approvedNo
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v41 / 17approvedNo
418amnondominant coral, ocean, mucus, echinopora mammiformis2018-12-02v41 / 17approvedNo
418amnoncommon coral, ocean, stylophora pistillata, mucus2018-12-02v41 / 17approvedNo
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v41 / 17approvedNo
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v41 / 17approvedNo
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v41 / 17approvedNo
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v31 / 17approvedNo
570amnon high in control compared to visceral leishmaniasis in homo sapiens feces india bihar state 2019-12-16v31 / 17approvedNo
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v31 / 17approvedNo
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v41 / 17approvedNo
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v41 / 17approvedNo
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 17approvedNo
607amnondominant germany, homo sapiens, feces, control2020-04-19v41 / 17approvedNo
630amnondominant madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v31 / 17approvedNo
639amnondominant nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v31 / 17approvedNo
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v41 / 17approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 17approvedNo
660amnondominant shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v41 / 17approvedNo
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v41 / 17approvedNo
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v41 / 17approvedNo
729amnondominant cameroon, wild, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v31 / 17approvedNo
730amnondominant control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v11 / 17approvedNo
743amnondominant feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v31 / 17approvedNo
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 17approvedNo
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v41 / 17approvedNo
777amnondominant 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 17approvedNo
777amnondominant 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 17approvedNo
797amnon high in breast fed compared to formula fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 17approvedNo
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 17approvedNo
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v41 / 17approvedNo
839amnondominant meerkat, suricata suricatta, kalahari desert, morning, south africa, feces2021-11-08v41 / 17approvedNo
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v31 / 17approvedNo
852amnondominant non-smoker, canada, adult, saliva, homo sapiens2021-12-17v41 / 17approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 17approvedNo
892amnondominant 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 17approvedNo
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v31 / 17approvedNo
922amnondominant no dental caries, 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v41 / 17approvedNo
927amnondominant punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v31 / 17approvedNo
941amnondominant homo sapiens, feces, thailand, adult, nan province, village, rural community2022-11-25v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, female, adult2022-12-20v41 / 17approvedNo
984amnondominant wild, state of california, united states of america, enhydra lutris nereis, sea otter, subgingival dental plaque, subgingival plaque, gingival groove2022-12-26v41 / 17approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, state of ohio, columbus, pan paniscus, bonobo2022-12-27v41 / 17approvedNo
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v41 / 18approvedNo
26amnondominant canis lupus familiaris, united states of america, saliva, mouth2016-12-05v41 / 18approvedNo
36amnondominant homo sapiens, feces, sichuan province2016-12-06v41 / 18approvedNo
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v41 / 18approvedNo
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v41 / 18approvedNo
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v41 / 18approvedNo
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v41 / 18approvedNo
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v41 / 18approvedNo
215amnondominant homo sapiens, feces, united states of america2017-10-23v41 / 18approvedNo
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v41 / 18approvedNo
246amnondominant homo sapiens, saliva, italy2017-11-21v41 / 18approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 18approvedNo
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 18approvedNo
293amnondominant homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v41 / 18approvedNo
294amnondominant homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 18approvedNo
294amnonhigh freq. in non-IBS healthy controls (dominant homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v41 / 18approvedNo
302amnonhigh freq. in feces of parakeet pet birds (dominant bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v41 / 18approvedNo
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v41 / 18approvedNo
331amnondominant feces, monkey, theropithecus gelada, ethiopia2018-05-13v41 / 18approvedNo
339amnondominant homo sapiens, feces, adult, india2018-05-24v41 / 18approvedNo
351amnondominant sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v41 / 18approvedNo
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v41 / 18approvedNo
384amnondominant equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v41 / 18approvedNo
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v41 / 18approvedNo
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v41 / 18approvedNo
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v41 / 18approvedNo
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v41 / 18approvedNo
423amnondominant bank vole, myodes glareolus, ukraine, feces2018-12-05v41 / 18approvedNo
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v41 / 18approvedNo
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v41 / 18approvedNo
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v41 / 18approvedNo
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v41 / 18approvedNo
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v41 / 18approvedNo
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v41 / 18approvedNo
488amnondominant canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v41 / 18approvedNo
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v11 / 18approvedNo
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v31 / 18approvedNo
561amnon high in winter withered grass diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v31 / 18approvedNo
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v41 / 18approvedNo
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v31 / 18approvedNo
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v41 / 18approvedNo
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v31 / 18approvedNo
625amnondominant state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v41 / 18approvedNo
625amnondominant emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v41 / 18approvedNo
627amnondominant feces, pregnancy, adult, female, china2020-05-16v31 / 18approvedNo
630amnon high in low physical activity sedentary compared to high physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v31 / 18approvedNo
642amnoncommon san diego, pacific ocean, chub mackerel, scomber japonicus, feces, digesta, fish2020-08-28v41 / 18approvedNo
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v41 / 18approvedNo
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v41 / 18approvedNo
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v41 / 18approvedNo
666amnondominant lama guanicoe, italy, feces2020-09-25v31 / 18approvedNo
666amnondominant european rabbit, oryctolagus cuniculus, italy, feces2020-09-25v31 / 18approvedNo
666amnondominant wild boar, sus scrofa, italy, feces2020-09-25v31 / 18approvedNo
666amnondominant brown bear, ursus arctos, italy, feces2020-09-25v31 / 18approvedNo
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 18approvedNo
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v31 / 18approvedNo
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v31 / 18approvedNo
739amnondominant age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v41 / 18approvedNo
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v31 / 18approvedNo
777amnoncommon 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
777amnondominant 18-month-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
777amnondominant 5-year-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
781amnondominant warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v41 / 18approvedNo
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 18approvedNo
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v31 / 18approvedNo
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v31 / 18approvedNo
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v31 / 18approvedNo
817amnondominant united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v41 / 18approvedNo
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v31 / 18approvedNo
833amnondominant homo sapiens, feces, age 60-65 years, slovak republic, adult, normal exercise2021-09-11v11 / 18approvedNo
841amnondominant human adult stage, state of texas, adult, saliva, united states of america, homo sapiens2021-11-08v41 / 18approvedNo
848amnoncommon 6-month-old human stage, infant, kingdom of spain, feces, homo sapiens2021-12-13v11 / 18approvedNo
865amnondominant inner mongolia autonomous region, china, dog, canis lupus familiaris, feces2022-02-08v31 / 18approvedNo
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v31 / 18approvedNo
875amnondominant human late adulthood stage, saen thong subdistrict, village, rural community, thailand, adult, homo sapiens, feces2022-03-04v31 / 18approvedNo
880amnondominant human adult stage, kingdom of denmark, adult, homo sapiens, feces2022-03-12v31 / 18approvedNo
885amnondominant human early adulthood stage, state of florida, united states of america, homo sapiens, feces2022-03-26v31 / 18approvedNo
892amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-04-07v41 / 18approvedNo
892amnondominant 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 18approvedNo
898amnondominant coyote, canis latrans, edmonton, adult organism, wild, canada, male, feces2022-04-19v41 / 18approvedNo
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v31 / 18approvedNo
922amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-07-25v41 / 18approvedNo
922amnondominant no dental caries, 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v41 / 18approvedNo
950amnoncommon cloacal swab, feces, coats island, canada, thick-billed murres, uria lomvia, bird2022-12-07v41 / 18approvedNo
957amnondominant adult, saliva, india, homo sapiens, pune2022-12-18v41 / 18approvedNo
966amnoncommon infant, 1-year-old human stage, gambia, rural community, homo sapiens, feces2022-12-21v31 / 18approvedNo
971amnondominant homo sapiens, adult, overweight body mass index status, feces, new zealand, auckland city2022-12-23v31 / 18approvedNo
974amnondominant in feces of marmosets reintroduced to the wild (dominant anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v41 / 18approvedNo
981amnondominant monkey, macaca nemestrina, macaque, united states of america, state of washington, captive, feces2022-12-25v31 / 18approvedNo
994amnondominant belgium, east flanders province, fire salamander, salamandra salamandra, wild, feces2022-12-27v31 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental black stain, no dental caries2022-12-30v31 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, no dental caries, no dental black stain2022-12-30v31 / 18approvedNo
997amnon high in no iron deficiency anemia compared to iron deficiency anemia in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province dental caries dental caries 2022-12-30v31 / 18approvedNo
1003amnondominant feces, homo sapiens, india, hyderabad2022-12-31v31 / 18approvedNo
1006amnondominant feces, monkey, captive, united states of america, state of maryland, research facility, bethesda, chlorocebus sabaeus, sabaeus monkey2023-01-08v41 / 18approvedNo
1011amnondominant bird, feces, serinus canaria, canary, italy, captive2023-02-03v31 / 18approvedNo
54amnondominant homo sapiens, saliva, united states of america2017-01-23v41 / 19approvedNo
60amnondominant anser cygnoides, feces, china2017-02-03v41 / 19approvedNo
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v41 / 19approvedNo
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v41 / 19approvedNo
99amnondominant commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v41 / 19approvedNo
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v41 / 19approvedNo
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v41 / 19approvedNo
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v41 / 19approvedNo
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v41 / 19approvedNo
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v41 / 19approvedNo
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 19approvedNo
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 19approvedNo
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v41 / 19approvedNo
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v41 / 19approvedNo
418amnon high in mucus compared to tissue in ocean coral diploastrea heliopora 2018-12-02v41 / 19approvedNo
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v41 / 19approvedNo
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 19approvedNo
449amnondominant homo sapiens, feces, colombia2019-01-09v41 / 19approvedNo
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v41 / 19approvedNo
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v41 / 19approvedNo
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v41 / 19approvedNo
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v41 / 19approvedNo
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v41 / 19approvedNo
489amnondominant feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v41 / 19approvedNo
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v41 / 19approvedNo
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v41 / 19approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 19approvedNo
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v31 / 19approvedNo
573amnondominant feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v41 / 19approvedNo
574amnondominant feces, homo sapiens, russia, adult2020-01-05v31 / 19approvedNo
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 19approvedNo
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v31 / 19approvedNo
666amnondominant south american tapir, tapirus terrestris, italy, feces2020-09-25v31 / 19approvedNo
671amnondominant age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 19approvedNo
678amnondominant tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v31 / 19approvedNo
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 19approvedNo
704amnondominant istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v31 / 19approvedNo
706amnondominant state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v41 / 19approvedNo
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v31 / 19approvedNo
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v31 / 19approvedNo
729amnondominant captive, monkey, feces, zoological garden, europe, pan troglodytes verus, western chimpanzee2021-01-05v31 / 19approvedNo
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v31 / 19approvedNo
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v31 / 19approvedNo
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 19approvedNo
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v31 / 19approvedNo
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v31 / 19approvedNo
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v31 / 19approvedNo
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 19approvedNo
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v31 / 19approvedNo
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 19approvedNo
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v41 / 19approvedNo
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 19approvedNo
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 19approvedNo
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 19approvedNo
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v31 / 19approvedNo
924amnondominant 8-year-old human stage, 7-year-old human stage, china, supragingival dental plaque, supragingival plaque, guangzhou city prefecture, child2022-07-27v31 / 19approvedNo
925amnondominant interproximal dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v31 / 19approvedNo
943amnondominant homo sapiens, feces, adult, united states of america, state of florida, cardiovascular risk group2022-11-25v31 / 19approvedNo
955amnondominant chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism, periodontitis, periodontitis2022-12-17v41 / 19approvedNo
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, control2022-12-19v41 / 19approvedNo
971amnondominant homo sapiens, adult, overweight body mass index status, feces, finland, helsinki2022-12-23v31 / 19approvedNo
972amnondominant homo sapiens, feces, united states of america, state of california, adult2022-12-24v41 / 19approvedNo
974amnondominant monkey, callithrix <genus>, marmosets, feces, brazil, anal swab, wild2022-12-24v41 / 19approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, saliva2022-12-26v31 / 19approvedNo
983amnon high in saliva compared to supragingival plaque supragingival dental plaque in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 19approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, iron deficiency anemia2022-12-30v31 / 19approvedNo
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v41 / 20approvedNo
1020amnondominant homo sapiens, feces, japan, adult, human adult stage, ulcerative colitis, remission2023-04-06v31 / 20approvedNo
26amnondominant united states of america, felis catus, saliva, mouth2016-12-05v41 / 20approvedNo
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v41 / 20approvedNo
46amnonsmj: higher in mice feces with antiobiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v41 / 20approvedNo
158amnondominant cat, felis catus, united states of america, saliva, mouth2017-07-06v41 / 20approvedNo
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v41 / 20approvedNo
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v41 / 20approvedNo
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v41 / 20approvedNo
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v41 / 20approvedNo
238amnondominant homo sapiens, feces, colombia2017-11-07v41 / 20approvedNo
242amnonhigh freq. in native-americans (dominant homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v41 / 20approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 20approvedNo
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v41 / 20approvedNo
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v41 / 20approvedNo
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v41 / 20approvedNo
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v41 / 20approvedNo
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v41 / 20approvedNo
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v41 / 20approvedNo
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v41 / 20approvedNo
344amnonhigh freq. in feces of homosexual males (dominant homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v41 / 20approvedNo
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v41 / 20approvedNo
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v41 / 20approvedNo
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v41 / 20approvedNo
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v41 / 20approvedNo
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v41 / 20approvedNo
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v41 / 20approvedNo
418amnoncommon coral, ocean, turbinaria reniformis, mucus2018-12-02v41 / 20approvedNo
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v41 / 20approvedNo
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v41 / 20approvedNo
434amnondominant rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v41 / 20approvedNo
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v41 / 20approvedNo
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v41 / 20approvedNo
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v41 / 20approvedNo
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v41 / 20approvedNo
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v31 / 20approvedNo
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v41 / 20approvedNo
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v31 / 20approvedNo
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v31 / 20approvedNo
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v41 / 20approvedNo
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v41 / 20approvedNo
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v41 / 20approvedNo
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 20approvedNo
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v41 / 20approvedNo
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v41 / 20approvedNo
639amnondominant lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v31 / 20approvedNo
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v41 / 20approvedNo
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v41 / 20approvedNo
666amnondominant canis lupus familiaris, dog, italy, feces2020-09-25v31 / 20approvedNo
671amnondominant age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 20approvedNo
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 20approvedNo
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v31 / 20approvedNo
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v31 / 20approvedNo
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v31 / 20approvedNo
730amnondominant crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v11 / 20approvedNo
734amnondominant vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 20approvedNo
759amnondominant wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v41 / 20approvedNo
766amnondominant n in feces of dog females within 24h after parturition (dominant french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v41 / 20approvedNo
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 20approvedNo
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 20approvedNo
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v31 / 20approvedNo
826amnondominant age 4 years, subgingival dental plaque, adult organism, female organism, dog, subgingival plaque, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v41 / 20approvedNo
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v31 / 20approvedNo
851amnondominant milan, italy, adult, homo sapiens, feces2021-12-16v31 / 20approvedNo
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 20approvedNo
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v31 / 20approvedNo
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v41 / 20approvedNo
881amnondominant bologna, adult organism, dog, italy, canis lupus familiaris, feces2022-03-12v31 / 20approvedNo
892amnondominant 1-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, infant, united states of america, homo sapiens2022-04-07v41 / 20approvedNo
892amnondominant 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 20approvedNo
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v31 / 20approvedNo
922amnondominant no dental caries, 1-year-old human stage, supragingival dental plaque, supragingival plaque, infant, dentition, united states of america, homo sapiens2022-07-25v41 / 20approvedNo
922amnondominant no dental caries, 4-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 20approvedNo
941amnon high in pig farm compared to chicken farm in farm rural community village nan province adult thailand feces homo sapiens 2022-11-25v41 / 20approvedNo
958amnondominant feces, homo sapiens, adult, united states of america, state of texas, mexican american, mexico2022-12-19v41 / 20approvedNo
998amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, adult, glasgow, united kingdom, periodontitis2022-12-30v31 / 20approvedNo
1019amnondominant homo sapiens, feces, infant, under-1-year-old human stage, latvia2023-04-03v31 / 21approvedNo
1020amnondominant homo sapiens, feces, japan, adult, human adult stage, control2023-04-06v31 / 21approvedNo
1021amnondominant homo sapiens, feces, russia, irkutsk, adolescent stage2023-04-06v31 / 21approvedNo
15amnondominant acinonyx jubatus, namibia, feces2016-11-08v41 / 21approvedNo
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v41 / 21approvedNo
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v41 / 21approvedNo
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v41 / 21approvedNo
72amnondominant canis lupus familiaris, feces, united states of america, iowa2017-02-25v41 / 21approvedNo
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v41 / 21approvedNo
122amnondominant homo sapiens, feces, united kingdom2017-04-13v41 / 21approvedNo
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v41 / 21approvedNo
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v41 / 21approvedNo
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v41 / 21approvedNo
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v41 / 21approvedNo
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v41 / 21approvedNo
249amnondominant homo sapiens, feces, united states of america2017-11-22v41 / 21approvedNo
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v41 / 21approvedNo
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v41 / 21approvedNo
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v41 / 21approvedNo
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v41 / 21approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v41 / 21approvedNo
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v41 / 21approvedNo
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v41 / 21approvedNo
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v41 / 21approvedNo
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v41 / 21approvedNo
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v41 / 21approvedNo
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v41 / 21approvedNo
406amnondominant feces, zoological garden, ceratotherium simum, white rhinoceros, french republic2018-11-21v41 / 21approvedNo
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v41 / 21approvedNo
418amnoncommon coral, ocean, porites cylindrica, mucus2018-12-02v41 / 21approvedNo
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v41 / 21approvedNo
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v41 / 21approvedNo
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v41 / 21approvedNo
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v41 / 21approvedNo
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v41 / 21approvedNo
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v41 / 21approvedNo
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v41 / 21approvedNo
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 21approvedNo
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v31 / 21approvedNo
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v31 / 21approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v41 / 21approvedNo
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v41 / 21approvedNo
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v31 / 21approvedNo
596amnoncommon 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 21approvedNo
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v31 / 21approvedNo
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v41 / 21approvedNo
626amnondominant red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v11 / 21approvedNo
642amnon high in gastrointestinal system alimentary part of gastrointestinal system compared to feces digesta in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v41 / 21approvedNo
658amnon high in hispanic hispanic or latin american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v31 / 21approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 21approvedNo
663amnon high in low bmi compared to obese body mass index status high bmi obesity in adult switzerland poland feces homo sapiens 2020-09-22v41 / 21approvedNo
666amnondominant zoological garden, hippopotamus amphibius, italy, feces2020-09-25v31 / 21approvedNo
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 21approvedNo
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 21approvedNo
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v31 / 21approvedNo
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v31 / 21approvedNo
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 21approvedNo
759amnondominant state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v41 / 21approvedNo
759amnondominant city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 21approvedNo
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 21approvedNo
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v41 / 21approvedNo
806amnondominant saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v31 / 21approvedNo
810amnondominant in sea turtle feces from sea turtle rescue center (dominant adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v31 / 21approvedNo
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v41 / 21approvedNo
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v31 / 21approvedNo
835amnondominant feces, homo sapiens, japan, adult2021-09-11v31 / 21approvedNo
848amnondominant 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 21approvedNo
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 21approvedNo
864amnondominant la michilia biosphere reserve, mexican wolf, dog food diet, canis lupus baileyi, municipality of suchil, captive, mexico, feces2022-02-08v31 / 21approvedNo
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v31 / 21approvedNo
870amnondominant fourth decade human stage, third decade human stage, auckland city, new zealand, adult, homo sapiens, feces2022-02-18v31 / 21approvedNo
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v41 / 21approvedNo
879amnondominant adult organism, captive, dog, austria, canis lupus familiaris, research facility, feces2022-03-12v41 / 21approvedNo
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v41 / 21approvedNo
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v41 / 21approvedNo
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v31 / 21approvedNo
925amnondominant lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v31 / 21approvedNo
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v31 / 21approvedNo
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 6-year-old human stage2022-12-20v41 / 21approvedNo
985amnondominant homo sapiens, hong kong, adult, saliva, oral rinse2022-12-26v11 / 21approvedNo
995amnondominant zoological garden, monkey, feces, united states of america, state of texas, houston, pongo pygmaeus, bornean orangutan2022-12-27v41 / 21approvedNo
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v41 / 22approvedNo
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v41 / 22approvedNo
120amnondominant homo sapiens, feces, brazil2017-04-12v41 / 22approvedNo
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v41 / 22approvedNo
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v41 / 22approvedNo
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v41 / 22approvedNo
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 22approvedNo
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v41 / 22approvedNo
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v41 / 22approvedNo
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v41 / 22approvedNo
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v41 / 22approvedNo
297amnon high in crohn's disease ulcerative colitis compared to control in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v41 / 22approvedNo
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v41 / 22approvedNo
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v41 / 22approvedNo
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v41 / 22approvedNo
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v41 / 22approvedNo
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v41 / 22approvedNo
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v41 / 22approvedNo
418amnoncommon coral, ocean, seriatopora caliendrum, mucus2018-12-02v41 / 22approvedNo
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v41 / 22approvedNo
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v41 / 22approvedNo
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v41 / 22approvedNo
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v41 / 22approvedNo
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 22approvedNo
552amnondominant feces, homo sapiens, czech republic2019-09-05v31 / 22approvedNo
593amnondominant homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v31 / 22approvedNo
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v31 / 22approvedNo
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 22approvedNo
625amnondominant black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v41 / 22approvedNo
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v41 / 22approvedNo
648amnondominant state of louisiana, feces, canis lupus familiaris, dog2020-09-06v41 / 22approvedNo
650amnondominant african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v41 / 22approvedNo
655amnondominant in patients before hematopoietic stem cell transplant (dominant before hsct, italy, feces, homo sapiens)2020-09-13v31 / 22approvedNo
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v31 / 22approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 22approvedNo
666amnondominant wild, wolf, canis lupus, italy, feces2020-09-25v31 / 22approvedNo
666amnondominant european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v31 / 22approvedNo
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 22approvedNo
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 22approvedNo
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v31 / 22approvedNo
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v31 / 22approvedNo
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v31 / 22approvedNo
759amnondominant state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v41 / 22approvedNo
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 22approvedNo
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 22approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 22approvedNo
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 22approvedNo
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 22approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 22approvedNo
865amnondominant wolf, china, canis lupus, feces2022-02-08v31 / 22approvedNo
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v31 / 22approvedNo
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v31 / 22approvedNo
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 22approvedNo
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v31 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v41 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 15-month-old human stage2022-12-20v41 / 22approvedNo
980amnondominant hangzhou city prefecture, china, feces, homo sapiens, mental depression2022-12-25v31 / 22approvedNo
1018amnondominant homo sapiens, china, 3-year-old human stage, daxin county, rural community, feces2023-04-03v31 / 23approvedNo
10amnondominant homo sapiens, feces, toronto2016-10-27v41 / 23approvedNo
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v41 / 23approvedNo
53amnondominant homo sapiens, feces, city, el salvador, small village2017-01-21v41 / 23approvedNo
1021amnondominant homo sapiens, feces, russia, irkutsk, adolescent stage, obese body mass index status, obesity, irritable bowel syndrome, irritable bowel syndrome2023-04-06v31 / 23approvedNo
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v41 / 23approvedNo
132amnondominant homo sapiens, feces, united states of america2017-04-16v41 / 23approvedNo
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to late timepoints age 35 weeks age in rat rattus research facility feces wistar rat czech republic )2017-08-23v41 / 23approvedNo
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v41 / 23approvedNo
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v41 / 23approvedNo
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v41 / 23approvedNo
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v41 / 23approvedNo
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v41 / 23approvedNo
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v41 / 23approvedNo
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 23approvedNo
303amnondominant homo sapiens, feces, germany, adult2018-03-12v41 / 23approvedNo
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v41 / 23approvedNo
344amnonhigh freq. in feces of heterosexuals (dominant homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v41 / 23approvedNo
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v41 / 23approvedNo
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v41 / 23approvedNo
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v41 / 23approvedNo
399amnondominant feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v41 / 23approvedNo
418amnondominant coral, ocean, acropora hyacinthus, mucus2018-12-02v41 / 23approvedNo
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v41 / 23approvedNo
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v41 / 23approvedNo
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v41 / 23approvedNo
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 23approvedNo
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v41 / 23approvedNo
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v41 / 23approvedNo
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v31 / 23approvedNo
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v41 / 23approvedNo
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v31 / 23approvedNo
626amnondominant strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v11 / 23approvedNo
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v31 / 23approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 23approvedNo
666amnondominant homo sapiens, italy, feces2020-09-25v31 / 23approvedNo
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 23approvedNo
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v31 / 23approvedNo
702amnondominant canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v41 / 23approvedNo
704amnondominant 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v31 / 23approvedNo
712amnondominant kazan, adult, russia, saliva, homo sapiens2028-05-21v31 / 23approvedNo
713amnondominant active disease, crohn's disease, feces, homo sapiens2028-05-21v31 / 23approvedNo
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 23approvedNo
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 23approvedNo
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v41 / 23approvedNo
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v41 / 23approvedNo
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v41 / 23approvedNo
843amnondominant non-celiac gluten sensitivity, human adult stage, italy, adult, feces2021-11-17v31 / 23approvedNo
892amnondominant 2-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 23approvedNo
922amnondominant no dental caries, 2-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 23approvedNo
952amnondominant cat, felis catus, state of oregon, united states of america, house cat, adult organism, feces2022-12-09v41 / 23approvedNo
978amnondominant feces, monkey, callithrix jacchus, marmosets, captive, research facility2022-12-24v41 / 23approvedNo
1010amnondominant feces, dog, canis lupus familiaris, united states of america, commonwealth of pennsylvania, control2023-02-02v41 / 23approvedNo
1010amnondominant feces, dog, canis lupus familiaris, united states of america, commonwealth of pennsylvania, abnormality of the intestine, chronic enteropathy, canine chronic enteropathy2023-02-02v41 / 23approvedNo
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v41 / 24approvedNo
150amnondominant canis lupus familiaris, dog, feces, united states of america2017-04-26v41 / 24approvedNo
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v41 / 24approvedNo
239amnondominant homo sapiens, feces, united states of america2017-11-08v41 / 24approvedNo
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v41 / 24approvedNo
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v41 / 24approvedNo
340amnondominant feces, felis catus, cat, city of melbourne, australia2018-05-27v41 / 24approvedNo
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v41 / 24approvedNo
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v41 / 24approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v41 / 24approvedNo
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v41 / 24approvedNo
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v41 / 24approvedNo
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v41 / 24approvedNo
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v41 / 24approvedNo
418amnoncommon coral, ocean, fungia, mucus2018-12-02v41 / 24approvedNo
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v41 / 24approvedNo
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v11 / 24approvedNo
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v41 / 24approvedNo
566amnondominant feces, china, homo sapiens, adult2019-11-24v41 / 24approvedNo
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v41 / 24approvedNo
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v31 / 24approvedNo
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v41 / 24approvedNo
617amnondominant alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v31 / 24approvedNo
620amnondominant feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v41 / 24approvedNo
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v31 / 24approvedNo
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v31 / 24approvedNo
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v41 / 24approvedNo
666amnondominant wild cat, felis silvestris, italy, feces2020-09-25v31 / 24approvedNo
683amnondominant state of california, united states of america, adult, feces, homo sapiens2028-03-04v41 / 24approvedNo
702amnondominant felis catus, cat, state of north carolina, united states of america, feces2028-04-02v41 / 24approvedNo
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in istanbul turkey child saliva homo sapiens )2028-04-02v31 / 24approvedNo
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v31 / 24approvedNo
721amnonhigher in high protein weight loss diet compared to control diet ( high in high protein diet weight loss diet weight loss compared to control diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v41 / 24approvedNo
723amnondominant 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v31 / 24approvedNo
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v31 / 24approvedNo
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in adult midwest region united states of america feces homo sapiens 2021-02-25v31 / 24approvedNo
753amnondominant china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v41 / 24approvedNo
815amnondominant lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v31 / 24approvedNo
826amnondominant age 4 years, supragingival dental plaque, adult organism, female organism, supragingival plaque, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v41 / 24approvedNo
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v31 / 24approvedNo
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v11 / 24approvedNo
947amnondominant feces, homo sapiens, adult, united states of america, commonwealth of pennsylvania2022-12-02v41 / 24approvedNo
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, ulcerative colitis, ulcerative colitis2022-12-19v41 / 24approvedNo
960amnoncommon 9-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 24approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v41 / 24approvedNo
997amnon high in dental black stain compared to no dental black stain in no dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 24approvedNo
1000amnondominant feces, homo sapiens, viet nam, adult, female, type 2 diabetes mellitus, obesity, obese body mass index status2022-12-31v31 / 24approvedNo
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v41 / 25approvedNo
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v41 / 25approvedNo
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 25approvedNo
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v41 / 25approvedNo
379amnondominant gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v41 / 25approvedNo
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v41 / 25approvedNo
418amnoncommon coral, ocean, physogyra lichtensteini, mucus2018-12-02v41 / 25approvedNo
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v41 / 25approvedNo
436amnondominant felis catus, cat, feces, united states of america, state of colorado2018-12-25v41 / 25approvedNo
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 25approvedNo
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v41 / 25approvedNo
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v31 / 25approvedNo
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v41 / 25approvedNo
683amnoncommon during antibiotics treatment in feces (common metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v41 / 25approvedNo
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 25approvedNo
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v41 / 25approvedNo
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v41 / 25approvedNo
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 25approvedNo
796amnondominant graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v31 / 25approvedNo
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 25approvedNo
848amnondominant 6-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 25approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 25approvedNo
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 25approvedNo
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v41 / 25approvedNo
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v31 / 25approvedNo
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 25approvedNo
982amnon high in winter compared to summer in ulan bator siberian musk deer moschus moschiferus china mongolia captive feces 2022-12-25v31 / 25approvedNo
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v41 / 26approvedNo
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v41 / 26approvedNo
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v41 / 26approvedNo
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v41 / 26approvedNo
406amnondominant feces, south africa, lycaon pictus, african wild dog2018-11-21v41 / 26approvedNo
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 26approvedNo
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v31 / 26approvedNo
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v31 / 26approvedNo
650amnonpositively correlated with BMI ( high in high bmi body mass index compared to low bmi in feces adult homo sapiens united states of america state of new york )2020-09-09v41 / 26approvedNo
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v41 / 26approvedNo
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v31 / 26approvedNo
766amnondominant age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 26approvedNo
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v41 / 26approvedNo
826amnondominant age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, saliva, research facility, united states of america2021-08-22v41 / 26approvedNo
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 26approvedNo
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v31 / 26approvedNo
941amnon high in chicken farm compared to pig farm in homo sapiens feces thailand adult nan province village rural community farm 2022-11-25v41 / 26approvedNo
955amnondominant subgingival dental plaque, subgingival plaque, chile, dog, canis lupus familiaris2022-12-17v41 / 26approvedNo
966amnondominant feces, homo sapiens, rural community, gambia, 1-year-old human stage, infant2022-12-21v31 / 26approvedNo
1000amnondominant feces, homo sapiens, viet nam, adult, female, control2022-12-31v31 / 26approvedNo
1010amnoncommon canine chronic enteropathy, chronic enteropathy, abnormality of the intestine, commonwealth of pennsylvania, united states of america, canis lupus familiaris, dog, feces2023-02-02v41 / 26approvedNo
131amnondominant homo sapiens, feces, south korea2017-04-16v41 / 27approvedNo
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in canis lupus familiaris dog feces united states of america exocrine pancreatic insufficiency )2017-04-26v41 / 27approvedNo
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v41 / 27approvedNo
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v41 / 27approvedNo
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 27approvedNo
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v41 / 27approvedNo
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v41 / 27approvedNo
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 27approvedNo
488amnondominant canis lupus familiaris, dog, feces, italy, control2019-02-25v41 / 27approvedNo
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v31 / 27approvedNo
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 27approvedNo
540amnondominant dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v41 / 27approvedNo
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v31 / 27approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v41 / 27approvedNo
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v41 / 27approvedNo
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v41 / 27approvedNo
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v41 / 27approvedNo
766amnon high in age 8 weeks puppy compared to age 2-7 years female organism adult organism in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 27approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 27approvedNo
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v31 / 27approvedNo
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v31 / 27approvedNo
943amnonlower before 6 day plant based diet ( high in vegetarian diet plant based diet compared to normal diet in homo sapiens feces adult united states of america state of florida cardiovascular risk group )2022-11-25v31 / 27approvedNo
959amnon high in ulcerative colitis ulcerative colitis compared to control in homo sapiens feces child 6-12 year-old child stage adolescent stage united states of america state of california los angeles 2022-12-19v41 / 27approvedNo
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 4-year-old human stage2022-12-20v41 / 27approvedNo
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v41 / 28approvedNo
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v41 / 28approvedNo
319amnondominant homo sapiens, feces, united states of america, state of texas2018-04-18v41 / 28approvedNo
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v41 / 28approvedNo
399amnondominant feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v41 / 28approvedNo
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 28approvedNo
530amnondominant snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v41 / 28approvedNo
540amnoncommon dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v41 / 28approvedNo
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v41 / 28approvedNo
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 28approvedNo
620amnondominant chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 28approvedNo
651amnon high in female compared to male in state of alabama united states of america adult feces homo sapiens 2020-09-13v41 / 28approvedNo
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in istanbul turkey child saliva homo sapiens )2028-04-02v31 / 28approvedNo
766amnoncommon age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v41 / 28approvedNo
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v41 / 28approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 28approvedNo
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v31 / 28approvedNo
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high protein diet, meat diet2021-08-29v41 / 28approvedNo
841amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america state of texas saliva homo sapiens 2021-11-08v41 / 28approvedNo
862amnoncommon qinghai province, china, himalayan griffon, gyps himalayensis, bird, feces2022-01-19v41 / 28approvedNo
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v41 / 29approvedNo
231amnonhigh freq. in dog rectum (dominant dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v41 / 29approvedNo
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v41 / 29approvedNo
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v41 / 29approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v41 / 29approvedNo
658amnon high in african american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 29approvedNo
666amnoncommon brown bear, ursus arctos, italy, feces2020-09-25v31 / 29approvedNo
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v31 / 29approvedNo
693amnon high in polycystic ovary syndrome compared to control in graz city district austria adult feces homo sapiens female 2028-03-16v11 / 29approvedNo
704amnon high in control compared to dental caries in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v31 / 29approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 29approvedNo
817amnon high in bronchoalveolar lavage lung compared to saliva oral wash cheek pouch oral cavity in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v41 / 29approvedNo
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, hydrolized diet2021-08-29v41 / 29approvedNo
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high fiber2021-08-29v41 / 29approvedNo
863amnon high in spring compared to winter in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v41 / 29approvedNo
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v31 / 29approvedNo
892amnoncommon supragingival plaque, supragingival dental plaque, 1-year-old human stage, dental plaque, infant, united states of america, homo sapiens2022-04-07v41 / 29approvedNo
922amnoncommon dentition, supragingival plaque, supragingival dental plaque, infant, 1-year-old human stage, no dental caries, united states of america, homo sapiens2022-07-25v41 / 29approvedNo
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v41 / 30approvedNo
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v41 / 30approvedNo
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v41 / 30approvedNo
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 30approvedNo
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v41 / 30approvedNo
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v41 / 30approvedNo
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v41 / 30approvedNo
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v41 / 30approvedNo
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 30approvedNo
573amnoncommon feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v41 / 30approvedNo
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v41 / 30approvedNo
658amnon high in european caucasian compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 30approvedNo
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v41 / 30approvedNo
723amnoncommon 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v31 / 30approvedNo
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v31 / 30approvedNo
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v31 / 30approvedNo
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 30approvedNo
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v41 / 30approvedNo
960amnoncommon 15-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 30approvedNo
983amnon high in saliva compared to tonsil surface tonsil in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 30approvedNo
997amnon high in no dental black stain compared to dental black stain in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province no dental caries 2022-12-30v31 / 30approvedNo
1020amnoncommon remission, ulcerative colitis, human adult stage, adult, japan, feces, homo sapiens2023-04-06v31 / 31approvedNo
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v41 / 31approvedNo
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 31approvedNo
233amnon high in age age < 3 months compared to infant stage age > 3 months in feces homo sapiens infant united states of america 2017-11-05v41 / 31approvedNo
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v41 / 31approvedNo
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v41 / 31approvedNo
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v41 / 31approvedNo
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v41 / 31approvedNo
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 31approvedNo
651amnon high in male compared to female in state of alabama united states of america adult feces homo sapiens 2020-09-13v41 / 31approvedNo
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v31 / 31approvedNo
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v31 / 31approvedNo
681amnondominant seoul, south korea, adult, homo sapiens, feces2028-03-04v31 / 31approvedNo
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v31 / 31approvedNo
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v31 / 31approvedNo
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v41 / 32approvedNo
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v41 / 32approvedNo
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v41 / 32approvedNo
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v41 / 32approvedNo
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v41 / 32approvedNo
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v41 / 32approvedNo
578amnon high in control compared to hiv infection in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v31 / 32approvedNo
666amnoncommon wild, wolf, canis lupus, italy, feces2020-09-25v31 / 32approvedNo
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in adult midwest region united states of america feces homo sapiens 2021-02-25v31 / 32approvedNo
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v31 / 32approvedNo
974amnon high in wild compared to zoological garden captive in monkey callithrix <genus> marmosets feces brazil anal swab 2022-12-24v41 / 32approvedNo
187amnonpositively correlated with age 25-35 weeks ( high in late time points age 35 weeks compared to early time points 25 weeks in rat rattus research facility feces wistar rat czech republic )2017-08-23v41 / 33approvedNo
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v41 / 33approvedNo
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v41 / 33approvedNo
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v41 / 33approvedNo
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v41 / 33approvedNo
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v41 / 33approvedNo
668amnon high in age 4 months compared to age 5 years in new zealand research facility feces felis catus cat 2020-09-26v31 / 33approvedNo
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 33approvedNo
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v31 / 33approvedNo
892amnoncommon 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 33approvedNo
922amnoncommon no dental caries, infant, 1-year-old human stage, saliva, united states of america, homo sapiens2022-07-25v41 / 33approvedNo
974amnoncommon wild, anal swab, brazil, feces, marmosets, callithrix <genus>, monkey2022-12-24v41 / 33approvedNo
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v41 / 34approvedNo
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v41 / 34approvedNo
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v41 / 34approvedNo
418amnoncommon coral, ocean, mucus, echinopora mammiformis2018-12-02v41 / 34approvedNo
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v41 / 34approvedNo
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v41 / 34approvedNo
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 34approvedNo
919amnoncommon 9-month-old human stage, 8-month-old human stage, 7-month-old human stage, 6-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 34approvedNo
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v41 / 35approvedNo
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v41 / 35approvedNo
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v41 / 35approvedNo
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 35approvedNo
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v41 / 35approvedNo
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v41 / 35approvedNo
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v41 / 35approvedNo
561amnon high in spring green stage diet compared to withered grass diet winter in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v31 / 35approvedNo
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 35approvedNo
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 35approvedNo
759amnon high in dog food diet compared to raw meat diet in dog canis lupus familiaris state of minnesota united states of america feces 2021-04-06v41 / 35approvedNo
864amnoncommon dog food diet, municipality of suchil, la michilia biosphere reserve, mexican wolf, canis lupus baileyi, captive, mexico, feces2022-02-08v31 / 35approvedNo
865amnon high in dog canis lupus familiaris compared to canis lupus wolf in china feces 2022-02-08v31 / 35approvedNo
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v31 / 35approvedNo
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v31 / 35approvedNo
955amnon high in control compared to periodontitis periodontitis in chile dog canis lupus familiaris subgingival dental plaque subgingival plaque adult organism 2022-12-17v41 / 35approvedNo
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v41 / 36approvedNo
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 36approvedNo
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 36approvedNo
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v41 / 36approvedNo
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v41 / 36approvedNo
399amnon high in ulcerative colitis compared to control in feces united states of america homo sapiens 2018-11-16v41 / 36approvedNo
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v41 / 36approvedNo
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v41 / 36approvedNo
596amnoncommon 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 36approvedNo
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v41 / 37approvedNo
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 37approvedNo
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v41 / 37approvedNo
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v41 / 37approvedNo
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v41 / 37approvedNo
651amnon high in parkinson's disease compared to control in state of alabama united states of america adult feces homo sapiens 2020-09-13v41 / 37approvedNo
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v31 / 37approvedNo
706amnoncommon state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v41 / 37approvedNo
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v31 / 37approvedNo
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v41 / 37approvedNo
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v11 / 37approvedNo
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 37approvedNo
297amnon high in control compared to crohn's disease ulcerative colitis in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v41 / 38approvedNo
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v41 / 38approvedNo
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v41 / 38approvedNo
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v41 / 38approvedNo
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v41 / 38approvedNo
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v41 / 38approvedNo
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v41 / 38approvedNo
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v31 / 38approvedNo
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 38approvedNo
679amnoncommon saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v31 / 38approvedNo
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 38approvedNo
982amnon high in winter compared to summer in china mongolia captive feces moschus berezovskii forest musk deer 2022-12-25v31 / 38approvedNo
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v41 / 39approvedNo
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v41 / 39approvedNo
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 39approvedNo
131amnonnegatively correlated with age (30-80 years) ( high in fifth decade human stage fourth decade human stage age compared to human late adulthood stage in homo sapiens feces south korea )2017-04-16v41 / 39approvedNo
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v41 / 39approvedNo
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v41 / 39approvedNo
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v41 / 39approvedNo
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v41 / 39approvedNo
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v31 / 39approvedNo
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v41 / 39approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 39approvedNo
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v31 / 39approvedNo
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v11 / 39approvedNo
959amnoncommon ulcerative colitis, ulcerative colitis, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 39approvedNo
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v41 / 40approvedNo
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v41 / 40approvedNo
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v41 / 40approvedNo
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v31 / 40approvedNo
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v31 / 40approvedNo
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 40approvedNo
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 40approvedNo
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v31 / 40approvedNo
51amnoncommon feces, homo sapiens, united states of america2017-01-19v41 / 41approvedNo
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 41approvedNo
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v41 / 41approvedNo
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v41 / 41approvedNo
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v41 / 41approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 41approvedNo
679amnon high in tonsil palatine tonsil compared to saliva in south korea age 5-10 years child fasting homo sapiens 2028-03-02v31 / 41approvedNo
806amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v31 / 41approvedNo
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v31 / 41approvedNo
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v41 / 41approvedNo
872amnoncommon age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v11 / 41approvedNo
881amnoncommon bologna, adult organism, italy, dog, canis lupus familiaris, feces2022-03-12v31 / 41approvedNo
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v31 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
1011amnoncommon captive, italy, canary, serinus canaria, feces, bird2023-02-03v31 / 41approvedNo
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v41 / 42approvedNo
60amnoncommon anser cygnoides, feces, china2017-02-03v41 / 42approvedNo
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v41 / 42approvedNo
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v41 / 42approvedNo
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v31 / 42approvedNo
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 42approvedNo
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v41 / 42approvedNo
922amnoncommon 4-year-old human stage, no dental caries, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 42approvedNo
986amnoncommon takahe, porphyrio hochstetteri, bird, new zealand, feces2022-12-26v31 / 42approvedNo
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v41 / 43approvedNo
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 43approvedNo
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v31 / 43approvedNo
666amnoncommon tiger, panthera tigris, italy, feces2020-09-25v31 / 43approvedNo
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v31 / 43approvedNo
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v31 / 43approvedNo
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v41 / 43approvedNo
892amnoncommon 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 43approvedNo
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v41 / 44approvedNo
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 44approvedNo
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v41 / 44approvedNo
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v41 / 44approvedNo
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 44approvedNo
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v41 / 44approvedNo
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v41 / 44approvedNo
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-02v41 / 44approvedNo
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v41 / 44approvedNo
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v31 / 44approvedNo
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v41 / 44approvedNo
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v31 / 44approvedNo
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v31 / 44approvedNo
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v31 / 44approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 44approvedNo
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v31 / 44approvedNo
974amnoncommon anal swab, monkey, callithrix <genus>, marmosets, feces, brazil, captive, zoological garden2022-12-24v41 / 44approvedNo
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 45approvedNo
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v31 / 45approvedNo
879amnon high in dog canis lupus familiaris compared to wolf canis lupus in captive adult organism austria research facility feces 2022-03-12v41 / 45approvedNo
984amnoncommon feces, sea otter, enhydra lutris nereis, united states of america, state of california, wild2022-12-26v41 / 45approvedNo
985amnon high in third decade human stage compared to human late adulthood stage in oral rinse saliva adult hong kong homo sapiens 2022-12-26v11 / 45approvedNo
1020amnoncommon control, human adult stage, adult, japan, feces, homo sapiens2023-04-06v31 / 46approvedNo
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v41 / 46approvedNo
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v41 / 46approvedNo
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 46approvedNo
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v41 / 46approvedNo
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v31 / 46approvedNo
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v31 / 46approvedNo
666amnoncommon canis lupus familiaris, dog, italy, feces2020-09-25v31 / 46approvedNo
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 46approvedNo
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v11 / 46approvedNo
971amnoncommon auckland city, new zealand, feces, overweight body mass index status, adult, homo sapiens2022-12-23v31 / 46approvedNo
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v41 / 47approvedNo
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v41 / 47approvedNo
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v41 / 47approvedNo
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in gallus gallus chicken feces united kingdom )2018-09-14v41 / 47approvedNo
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v41 / 47approvedNo
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v41 / 47approvedNo
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v41 / 47approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v41 / 47approvedNo
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v31 / 47approvedNo
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v41 / 47approvedNo
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v41 / 47approvedNo
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v41 / 47approvedNo
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v41 / 47approvedNo
1012amnoncommon apiary, england, beehive, honey, honeybee, apis mellifera2023-03-09v11 / 47approvedNo
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v31 / 48approvedNo
666amnoncommon short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v31 / 48approvedNo
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v31 / 48approvedNo
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v31 / 48approvedNo
892amnoncommon 2-year-old human stage, child, supragingival dental plaque, dental plaque, supragingival plaque, united states of america, homo sapiens2022-04-07v41 / 48approvedNo
922amnoncommon 2-year-old human stage, child, no dental caries, supragingival dental plaque, supragingival plaque, dentition, united states of america, homo sapiens2022-07-25v41 / 48approvedNo
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v41 / 49approvedNo
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 49approvedNo
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v41 / 49approvedNo
645amnoncommon feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v41 / 49approvedNo
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 49approvedNo
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v41 / 49approvedNo
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 49approvedNo
1010amnoncommon control, commonwealth of pennsylvania, united states of america, canis lupus familiaris, dog, feces2023-02-02v41 / 49approvedNo
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v41 / 50approvedNo
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v41 / 50approvedNo
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v41 / 50approvedNo
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 50approvedNo
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v31 / 50approvedNo
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 50approvedNo
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 50approvedNo
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v11 / 50approvedNo
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v31 / 50approvedNo
898amnoncommon wild, feces, coyote, canis latrans, adult organism, male, edmonton, canada2022-04-19v41 / 50approvedNo
960amnoncommon 18-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 50approvedNo
984amnoncommon gingival groove, subgingival plaque, subgingival dental plaque, sea otter, enhydra lutris nereis, united states of america, state of california, wild2022-12-26v41 / 50approvedNo
1018amnoncommon feces, rural community, daxin county, 3-year-old human stage, china, homo sapiens2023-04-03v31 / 51approvedNo
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v41 / 51approvedNo
16amnon high in control compared to diarrhea in felis catus state of california feces 2016-11-08v41 / 51approvedNo
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v41 / 51approvedNo
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 51approvedNo
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v41 / 51approvedNo
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 51approvedNo
702amnoncommon felis catus, cat, state of north carolina, united states of america, feces2028-04-02v41 / 51approvedNo
730amnoncommon crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v11 / 51approvedNo
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v31 / 51approvedNo
865amnoncommon canis lupus, wolf, china, feces2022-02-08v31 / 51approvedNo
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 51approvedNo
925amnoncommon vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v31 / 51approvedNo
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 52approvedNo
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v41 / 52approvedNo
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v41 / 52approvedNo
598amnonhigher in mouthwash of students compared to teachers ( high in 14-year-old human stage 13-year-old human stage child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 52approvedNo
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v41 / 52approvedNo
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v41 / 52approvedNo
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 52approvedNo
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v31 / 52approvedNo
730amnon high in control compared to crohn's disease in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v11 / 52approvedNo
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v31 / 52approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v31 / 52approvedNo
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v41 / 52approvedNo
847amnoncommon ninth decade human stage, 80 year-old and over human stage, japan, feces2021-12-01v11 / 52approvedNo
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 52approvedNo
995amnon high in columbus state of ohio compared to houston state of texas in captive gorilla gorilla united states of america feces monkey zoological garden 2022-12-27v41 / 52approvedNo
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v41 / 53approvedNo
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v41 / 53approvedNo
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v41 / 53approvedNo
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v31 / 53approvedNo
864amnoncommon municipality of timilpan, ocotal state park, raw meat diet, feces, mexico, captive, mexican wolf, canis lupus baileyi2022-02-08v31 / 53approvedNo
892amnon high in supragingival plaque supragingival dental plaque dental plaque compared to saliva in 4-year-old human stage child united states of america homo sapiens 2022-04-07v41 / 53approvedNo
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v31 / 53approvedNo
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v41 / 54approvedNo
847amnoncommon eleventh decade human stage, centenarian human stage, japan, feces2021-12-01v11 / 54approvedNo
847amnoncommon human early adulthood stage, japan, feces2021-12-01v11 / 54approvedNo
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v41 / 55approvedNo
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v41 / 55approvedNo
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v41 / 55approvedNo
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v41 / 55approvedNo
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v41 / 55approvedNo
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v31 / 55approvedNo
653amnon high in saliva compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 55approvedNo
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v41 / 55approvedNo
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 55approvedNo
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v31 / 55approvedNo
766amnoncommon in feces of dog females within 24h after parturition (common french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v41 / 55approvedNo
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v31 / 55approvedNo
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v41 / 55approvedNo
926amnoncommon 2-5 year-old child stage, supragingival plaque, supragingival dental plaque, child, orenburg, russia, homo sapiens2022-07-28v31 / 55approvedNo
967amnon high in young adult organism age 6-10 years compared to old organism age 18-24 years in female organism adult organism thailand wildlife sactuary phu khieo wildlife sanctuary macaca assamensis monkey assamese macaque wild feces 2022-12-23v31 / 55approvedNo
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 56approvedNo
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v41 / 56approvedNo
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v41 / 56approvedNo
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v41 / 56approvedNo
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v41 / 56approvedNo
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v31 / 56approvedNo
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v41 / 56approvedNo
648amnon high in control compared to antibiotic metronidazole in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v41 / 56approvedNo
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v41 / 56approvedNo
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v31 / 56approvedNo
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v41 / 56approvedNo
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v31 / 56approvedNo
817amnon high in oral cavity cheek pouch oral wash saliva compared to bronchoalveolar lavage lung in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v41 / 56approvedNo
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v41 / 56approvedNo
922amnoncommon 4-year-old human stage, no dental caries, child, saliva, united states of america, homo sapiens2022-07-25v41 / 56approvedNo
925amnoncommon lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v31 / 56approvedNo
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v31 / 56approvedNo
985amnon high in human late adulthood stage compared to third decade human stage in homo sapiens hong kong adult saliva oral rinse 2022-12-26v11 / 56approvedNo
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v41 / 57approvedNo
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v11 / 57approvedNo
596amnoncommon 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 57approvedNo
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v41 / 57approvedNo
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v41 / 57approvedNo
759amnoncommon state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v41 / 57approvedNo
892amnoncommon 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 57approvedNo
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v41 / 58approvedNo
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v41 / 58approvedNo
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v41 / 58approvedNo
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v41 / 58approvedNo
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v41 / 58approvedNo
666amnoncommon homo sapiens, italy, feces2020-09-25v31 / 58approvedNo
759amnoncommon wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v41 / 58approvedNo
806amnon high in oral wash oral cavity compared to supragingival plaque supragingival dental plaque dentition in homo sapiens adult state of new york united states of america 2021-06-19v31 / 58approvedNo
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v41 / 58approvedNo
866amnon high in iga negative fraction compared to iga positive fraction in human adult stage adult homo sapiens united states of america feces 2022-02-08v41 / 58approvedNo
877amnon high in high breath methane content compared to low breath methane content in human early adulthood stage austria adult homo sapiens feces 2022-03-08v41 / 58approvedNo
922amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v41 / 58approvedNo
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v41 / 59approvedNo
596amnoncommon 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 59approvedNo
843amnoncommon non-celiac gluten sensitivity, italy, feces, human adult stage, adult2021-11-17v31 / 59approvedNo
892amnoncommon 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 59approvedNo
922amnoncommon child, 2-year-old human stage, no dental caries, saliva, united states of america, homo sapiens2022-07-25v41 / 59approvedNo
980amnoncommon mental depression, homo sapiens, feces, china, hangzhou city prefecture2022-12-25v31 / 59approvedNo
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v41 / 60approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v41 / 60approvedNo
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v41 / 60approvedNo
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 60approvedNo
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v31 / 60approvedNo
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 60approvedNo
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v31 / 60approvedNo
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 60approvedNo
925amnoncommon supragingival dental plaque, supragingival plaque, interproximal dental plaque, kingdom of spain, adolescent stage, homo sapiens2022-07-28v31 / 60approvedNo
978amnoncommon research facility, captive, marmosets, callithrix jacchus, monkey, feces2022-12-24v41 / 60approvedNo
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v41 / 61approvedNo
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v41 / 61approvedNo
586amnon high in control diet compared to fructose diet fructose in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v41 / 61approvedNo
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 61approvedNo
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v31 / 61approvedNo
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v31 / 61approvedNo
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v31 / 61approvedNo
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v41 / 62approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v41 / 62approvedNo
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v31 / 62approvedNo
851amnoncommon feces, milan, italy, adult, homo sapiens2021-12-16v31 / 62approvedNo
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 62approvedNo
943amnoncommon cardiovascular risk group, state of florida, united states of america, adult, feces, homo sapiens2022-11-25v31 / 62approvedNo
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 63approvedNo
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v41 / 63approvedNo
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v41 / 63approvedNo
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v41 / 63approvedNo
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v41 / 63approvedNo
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v41 / 63approvedNo
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v41 / 63approvedNo
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v41 / 63approvedNo
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v31 / 63approvedNo
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v31 / 63approvedNo
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v31 / 63approvedNo
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 63approvedNo
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v31 / 64approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 64approvedNo
695amnon high in sesame allergy compared to milk allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v41 / 64approvedNo
865amnoncommon inner mongolia autonomous region, china, feces, dog, canis lupus familiaris2022-02-08v31 / 64approvedNo
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 64approvedNo
957amnoncommon adult, saliva, india, homo sapiens, pune2022-12-18v41 / 64approvedNo
1003amnoncommon hyderabad, india, homo sapiens, feces2022-12-31v31 / 64approvedNo
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v41 / 65approvedNo
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v41 / 65approvedNo
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v41 / 65approvedNo
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v41 / 65approvedNo
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v41 / 65approvedNo
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v31 / 65approvedNo
875amnoncommon saen thong subdistrict, village, rural community, thailand, adult, human late adulthood stage, feces, homo sapiens2022-03-04v31 / 65approvedNo
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v41 / 65approvedNo
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 65approvedNo
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v41 / 66approvedNo
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v41 / 66approvedNo
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 66approvedNo
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 66approvedNo
852amnoncommon non-smoker, canada, adult, saliva, homo sapiens2021-12-17v41 / 66approvedNo
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v41 / 67approvedNo
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v41 / 67approvedNo
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v41 / 67approvedNo
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v31 / 67approvedNo
805amnon high in non-smoker compared to cigarette smoking nicotine dependence smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v31 / 67approvedNo
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v31 / 67approvedNo
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v41 / 67approvedNo
941amnoncommon chicken farm, rural community, village, nan province, adult, farm, thailand, feces, homo sapiens2022-11-25v41 / 67approvedNo
941amnoncommon rural community, village, nan province, adult, thailand, feces, homo sapiens2022-11-25v41 / 67approvedNo
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v41 / 68approvedNo
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 68approvedNo
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v41 / 68approvedNo
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v41 / 68approvedNo
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v31 / 68approvedNo
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v31 / 68approvedNo
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v31 / 68approvedNo
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 68approvedNo
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v41 / 68approvedNo
952amnoncommon feces, adult organism, house cat, united states of america, state of oregon, felis catus, cat2022-12-09v41 / 68approvedNo
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v41 / 69approvedNo
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v41 / 69approvedNo
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in gallus gallus chicken feces united kingdom )2018-09-14v41 / 69approvedNo
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v41 / 69approvedNo
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v31 / 69approvedNo
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 69approvedNo
846amnoncommon commonwealth of massachusetts, united states of america, human adult stage, adult, stimulated saliva, saliva, homo sapiens2021-11-20v31 / 69approvedNo
941amnoncommon rural community, village, nan province, adult, pig farm, farm, thailand, feces, homo sapiens2022-11-25v41 / 69approvedNo
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v41 / 70approvedNo
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v41 / 70approvedNo
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v41 / 70approvedNo
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v41 / 70approvedNo
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v41 / 70approvedNo
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v41 / 70approvedNo
552amnoncommon feces, homo sapiens, czech republic2019-09-05v31 / 70approvedNo
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v41 / 70approvedNo
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v31 / 70approvedNo
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 70approvedNo
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v41 / 70approvedNo
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v41 / 71approvedNo
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v41 / 71approvedNo
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v41 / 71approvedNo
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v41 / 71approvedNo
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v41 / 71approvedNo
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v41 / 71approvedNo
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v41 / 71approvedNo
656amnoncommon child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v31 / 71approvedNo
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v41 / 71approvedNo
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v31 / 71approvedNo
914amnon high in control compared to diarrhea in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v31 / 71approvedNo
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v41 / 72approvedNo
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v41 / 72approvedNo
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v41 / 72approvedNo
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 72approvedNo
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v41 / 72approvedNo
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v31 / 72approvedNo
817amnoncommon united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v41 / 72approvedNo
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v31 / 72approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 72approvedNo
879amnoncommon canis lupus familiaris, dog, adult organism, captive, austria, research facility, feces2022-03-12v41 / 72approvedNo
1020amnon high in control compared to remission ulcerative colitis in homo sapiens feces japan adult human adult stage 2023-04-06v31 / 73approvedNo
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v41 / 73approvedNo
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v41 / 73approvedNo
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v41 / 73approvedNo
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v41 / 73approvedNo
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v31 / 73approvedNo
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v11 / 73approvedNo
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v41 / 73approvedNo
971amnoncommon helsinki, finland, feces, overweight body mass index status, adult, homo sapiens2022-12-23v31 / 73approvedNo
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v41 / 74approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v41 / 74approvedNo
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v41 / 74approvedNo
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v31 / 74approvedNo
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 74approvedNo
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v31 / 74approvedNo
759amnon high in raw meat diet compared to dog food diet in dog canis lupus familiaris state of minnesota united states of america feces 2021-04-06v41 / 74approvedNo
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v31 / 74approvedNo
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v41 / 74approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
983amnon high in supragingival plaque supragingival dental plaque compared to tonsil surface tonsil in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 74approvedNo
997amnon high in control no dental caries compared to dental caries dental caries in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province 2022-12-30v31 / 74approvedNo
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v41 / 75approvedNo
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v41 / 75approvedNo
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v41 / 75approvedNo
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v41 / 75approvedNo
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v31 / 75approvedNo
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v41 / 75approvedNo
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 75approvedNo
74amnoncommon united states of america, feces, homo sapiens2017-02-27v41 / 76approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v41 / 76approvedNo
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v41 / 76approvedNo
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v41 / 76approvedNo
663amnon high in switzerland compared to poland in adult feces homo sapiens 2020-09-22v41 / 76approvedNo
666amnoncommon pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v31 / 76approvedNo
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v31 / 76approvedNo
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v41 / 76approvedNo
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v41 / 77approvedNo
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v41 / 77approvedNo
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v41 / 77approvedNo
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v41 / 77approvedNo
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v41 / 77approvedNo
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v11 / 77approvedNo
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 77approvedNo
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v31 / 77approvedNo
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v31 / 77approvedNo
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v31 / 77approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v41 / 78approvedNo
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v31 / 78approvedNo
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v31 / 78approvedNo
759amnon high in wildlife sactuary canis lupus wolf compared to dog canis lupus familiaris in state of minnesota united states of america feces 2021-04-06v41 / 78approvedNo
898amnon high in descending colon ascending colon feces compared to jejunum duodenum in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v41 / 78approvedNo
974amnoncommon in feces of marmosets reintroduced to the wild (common anal swab, captive, brazil, feces, marmosets, callithrix <genus>, monkey)2022-12-24v41 / 78approvedNo
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v41 / 79approvedNo
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v41 / 79approvedNo
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v41 / 79approvedNo
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v41 / 79approvedNo
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v41 / 79approvedNo
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v31 / 79approvedNo
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 79approvedNo
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 79approvedNo
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v31 / 79approvedNo
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v31 / 79approvedNo
777amnoncommon 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 79approvedNo
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 79approvedNo
822amnon high in high fiber compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v41 / 79approvedNo
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v31 / 79approvedNo
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v41 / 80approvedNo
406amnonlower in captive white rhinoceros compared to wild ( high in wild south africa compared to captive french republic in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v41 / 80approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v41 / 80approvedNo
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v41 / 80approvedNo
983amnon high in tonsil surface tonsil compared to supragingival plaque supragingival dental plaque in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 80approvedNo
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v41 / 81approvedNo
339amnoncommon homo sapiens, feces, adult, india2018-05-24v41 / 81approvedNo
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v41 / 81approvedNo
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v31 / 81approvedNo
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v41 / 81approvedNo
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 81approvedNo
678amnon high in control compared to tooth disease black dental staining in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v31 / 81approvedNo
777amnon high in 3-year-old human stage compared to 5-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 81approvedNo
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 81approvedNo
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v41 / 81approvedNo
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v41 / 82approvedNo
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v41 / 82approvedNo
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v41 / 82approvedNo
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v41 / 82approvedNo
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v41 / 82approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 82approvedNo
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v31 / 82approvedNo
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v41 / 82approvedNo
955amnoncommon chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism2022-12-17v41 / 82approvedNo
977amnoncommon in raw milk used for cheese production (common raw milk, milk, brazil, minas gerais state)2022-12-24v41 / 82approvedNo
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v41 / 83approvedNo
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v41 / 83approvedNo
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v41 / 83approvedNo
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v41 / 83approvedNo
648amnoncommon united states of america, dog, canis lupus familiaris, feces, state of louisiana2020-09-06v41 / 83approvedNo
721amnon high in high protein diet weight loss weight loss diet compared to high fiber fiber diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v41 / 83approvedNo
777amnoncommon 5-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 83approvedNo
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 83approvedNo
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v41 / 83approvedNo
959amnoncommon control, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 83approvedNo
1021amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in homo sapiens feces russia irkutsk adolescent stage obesity obese body mass index status 2023-04-06v31 / 84approvedNo
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v41 / 84approvedNo
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v41 / 84approvedNo
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v41 / 84approvedNo
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v41 / 84approvedNo
961amnoncommon 4-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v41 / 84approvedNo
972amnoncommon adult, state of california, united states of america, feces, homo sapiens2022-12-24v41 / 84approvedNo
985amnoncommon oral rinse, saliva, adult, hong kong, homo sapiens2022-12-26v11 / 84approvedNo
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v41 / 85approvedNo
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v41 / 85approvedNo
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v41 / 85approvedNo
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v41 / 85approvedNo
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v41 / 85approvedNo
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v41 / 85approvedNo
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v41 / 85approvedNo
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v31 / 85approvedNo
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v31 / 85approvedNo
802amnoncommon cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v41 / 85approvedNo
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v41 / 85approvedNo
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v31 / 85approvedNo
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v31 / 85approvedNo
998amnon high in before therapy compared to non-surgical periodontal therapy in homo sapiens subgingival dental plaque subgingival plaque adult glasgow united kingdom periodontitis 2022-12-30v31 / 85approvedNo
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v41 / 86approvedNo
249amnoncommon homo sapiens, feces, united states of america2017-11-22v41 / 86approvedNo
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v41 / 86approvedNo
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v41 / 86approvedNo
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 86approvedNo
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v41 / 86approvedNo
947amnoncommon commonwealth of pennsylvania, united states of america, adult, homo sapiens, feces2022-12-02v41 / 86approvedNo
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v41 / 87approvedNo
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v41 / 87approvedNo
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v41 / 87approvedNo
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v41 / 87approvedNo
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v41 / 87approvedNo
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v31 / 87approvedNo
892amnoncommon saliva, united states of america, human adult stage, adult, homo sapiens2022-04-07v41 / 87approvedNo
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 87approvedNo
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v41 / 88approvedNo
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v41 / 88approvedNo
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v41 / 88approvedNo
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v41 / 88approvedNo
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in shuar population village rural community ecuador feces homo sapiens )2020-09-20v41 / 88approvedNo
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v31 / 88approvedNo
822amnon high in hydrolized diet compared to high fiber in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v41 / 88approvedNo
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v41 / 88approvedNo
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v41 / 88approvedNo
914amnon high in diarrhea compared to control in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v31 / 88approvedNo
922amnoncommon human adult stage, united states of america, saliva, adult, homo sapiens2022-07-25v41 / 88approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v41 / 89approvedNo
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v41 / 89approvedNo
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v41 / 89approvedNo
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v41 / 89approvedNo
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 89approvedNo
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v41 / 89approvedNo
997amnon high in iron deficiency anemia compared to no iron deficiency anemia in dental caries dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 89approvedNo
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v41 / 90approvedNo
962amnoncommon state of rhode island, c57bl/6, female organism, united states of america, feces, research facility, mus musculus, mouse2022-12-20v41 / 90approvedNo
137amnon high in juvenile stage compared to adult in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v41 / 91approvedNo
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v41 / 91approvedNo
666amnoncommon wild cat, felis silvestris, italy, feces2020-09-25v31 / 91approvedNo
958amnoncommon mexico, mexican american, state of texas, united states of america, adult, homo sapiens, feces2022-12-19v41 / 91approvedNo
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v41 / 92approvedNo
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v31 / 92approvedNo
668amnon high in age 5 years compared to age 4 months in new zealand research facility feces felis catus cat 2020-09-26v31 / 92approvedNo
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v31 / 92approvedNo
777amnoncommon 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 92approvedNo
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v41 / 92approvedNo
967amnon high in old organism age 18-24 years compared to young adult organism age 6-10 years in feces wild assamese macaque monkey macaca assamensis phu khieo wildlife sanctuary wildlife sactuary thailand adult organism female organism 2022-12-23v31 / 92approvedNo
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v41 / 93approvedNo
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v41 / 93approvedNo
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v41 / 93approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 93approvedNo
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v31 / 93approvedNo
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v31 / 93approvedNo
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 93approvedNo
982amnon high in summer compared to winter in forest musk deer moschus berezovskii feces captive mongolia china 2022-12-25v31 / 93approvedNo
992amnoncommon temp 28c, port stephens council, research facility, australia, hemolymph, sydney rock oyster, saccostrea glomerata2022-12-27v31 / 93approvedNo
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v41 / 94approvedNo
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v41 / 94approvedNo
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v41 / 94approvedNo
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v41 / 94approvedNo
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v41 / 94approvedNo
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v41 / 94approvedNo
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v41 / 94approvedNo
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 94approvedNo
17amnon high in low altitude compared to high altitude in ochotona feces stomach tibetan plateau 2016-11-09v41 / 95approvedNo
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v41 / 95approvedNo
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v41 / 95approvedNo
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v41 / 95approvedNo
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v41 / 95approvedNo
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v31 / 95approvedNo
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v31 / 95approvedNo
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v41 / 95approvedNo
998amnoncommon periodontitis, united kingdom, glasgow, adult, subgingival plaque, subgingival dental plaque, homo sapiens2022-12-30v31 / 95approvedNo
238amnoncommon homo sapiens, feces, colombia2017-11-07v41 / 96approvedNo
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v41 / 96approvedNo
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v31 / 96approvedNo
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v31 / 96approvedNo
678amnoncommon tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v31 / 96approvedNo
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v41 / 96approvedNo
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v31 / 96approvedNo
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v41 / 97approvedNo
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v41 / 97approvedNo
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v41 / 97approvedNo
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v41 / 97approvedNo
730amnoncommon control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v11 / 97approvedNo
839amnoncommon morning, south africa, kalahari desert, feces, meerkat, suricata suricatta2021-11-08v41 / 97approvedNo
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 97approvedNo
961amnon high in 4-year-old human stage compared to 6-year-old human stage in zealand kingdom of denmark child homo sapiens feces 2022-12-20v41 / 97approvedNo
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v11 / 98approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 98approvedNo
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v41 / 98approvedNo
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v41 / 98approvedNo
26amnoncommon canis lupus familiaris, united states of america, saliva, mouth2016-12-05v41 / 99approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v41 / 99approvedNo
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v41 / 99approvedNo
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 99approvedNo
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v41 / 100approvedNo
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v41 / 100approvedNo
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v41 / 100approvedNo
702amnon high in felis catus cat compared to canis lupus familiaris dog in state of north carolina united states of america feces 2028-04-02v41 / 100approvedNo
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v41 / 100approvedNo
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v41 / 101approvedNo
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v41 / 101approvedNo
766amnon high in age 2-7 years female organism adult organism compared to age 8 weeks puppy in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 101approvedNo
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v31 / 101approvedNo
961amnoncommon 6-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v41 / 101approvedNo
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v41 / 102approvedNo
704amnon high in dental caries compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v31 / 102approvedNo
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v41 / 102approvedNo
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v41 / 102approvedNo
922amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v41 / 102approvedNo
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v41 / 103approvedNo
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v41 / 103approvedNo
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v41 / 103approvedNo
822amnon high in meat diet high protein diet compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v41 / 103approvedNo
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v41 / 104approvedNo
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v41 / 104approvedNo
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v11 / 104approvedNo
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 104approvedNo
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v31 / 104approvedNo
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v41 / 105approvedNo
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v41 / 105approvedNo
704amnoncommon 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v31 / 105approvedNo
888amnoncommon cow milk based food product, skimmed milk powder, milk powder, ireland, milk2022-03-30v31 / 105approvedNo
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v41 / 106approvedNo
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 106approvedNo
712amnoncommon kazan, adult, russia, saliva, homo sapiens2028-05-21v31 / 106approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 106approvedNo
806amnoncommon saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v31 / 106approvedNo
980amnoncommon control, hangzhou city prefecture, china, feces, homo sapiens2022-12-25v31 / 106approvedNo
215amnoncommon homo sapiens, feces, united states of america2017-10-23v41 / 107approvedNo
273amnon high in 1-month-old human stage age compared to 1-month-old human stage age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 107approvedNo
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v41 / 107approvedNo
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v41 / 107approvedNo
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v41 / 107approvedNo
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v41 / 107approvedNo
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 107approvedNo
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v41 / 107approvedNo
704amnoncommon istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v31 / 107approvedNo
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v41 / 107approvedNo
892amnon high in saliva compared to supragingival plaque supragingival dental plaque dental plaque in 4-year-old human stage child united states of america homo sapiens 2022-04-07v41 / 107approvedNo
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v41 / 108approvedNo
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v41 / 108approvedNo
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v41 / 108approvedNo
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v41 / 108approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v41 / 108approvedNo
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v41 / 108approvedNo
997amnon high in dental caries dental caries compared to control no dental caries in shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 108approvedNo
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v41 / 109approvedNo
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 109approvedNo
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v41 / 109approvedNo
960amnoncommon adult, female, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 109approvedNo
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v41 / 110approvedNo
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v41 / 110approvedNo
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v41 / 110approvedNo
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v41 / 110approvedNo
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v41 / 110approvedNo
822amnon high in hydrolized diet compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v41 / 110approvedNo
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v41 / 111approvedNo
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v41 / 111approvedNo
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v41 / 111approvedNo
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v41 / 111approvedNo
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v41 / 112approvedNo
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v41 / 112approvedNo
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v41 / 112approvedNo
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v41 / 112approvedNo
863amnon high in winter compared to spring in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v41 / 112approvedNo
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v11 / 112approvedNo
71amnoncommon liolaemus ruibali, feces, argentina, research facility2017-02-25v41 / 113approvedNo
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v41 / 113approvedNo
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v41 / 113approvedNo
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v41 / 113approvedNo
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v41 / 113approvedNo
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v41 / 113approvedNo
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v31 / 113approvedNo
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v41 / 114approvedNo
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v41 / 114approvedNo
981amnoncommon feces, captive, state of washington, united states of america, macaque, macaca nemestrina, monkey2022-12-25v31 / 114approvedNo
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v41 / 115approvedNo
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v31 / 115approvedNo
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v31 / 115approvedNo
983amnoncommon saliva, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 115approvedNo
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v41 / 116approvedNo
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v41 / 116approvedNo
592amnoncommon wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v11 / 116approvedNo
1000amnoncommon obese body mass index status, obesity, type 2 diabetes mellitus, female, adult, viet nam, homo sapiens, feces2022-12-31v31 / 116approvedNo
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v41 / 117approvedNo
239amnoncommon homo sapiens, feces, united states of america2017-11-08v41 / 117approvedNo
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v41 / 117approvedNo
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 117approvedNo
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 118approvedNo
658amnon high in asian burmese compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 118approvedNo
822amnon high in high fiber compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v41 / 118approvedNo
983amnoncommon supragingival dental plaque, supragingival plaque, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 118approvedNo
986amnon high in wild diet compared to feed supplement diet in takahe porphyrio hochstetteri bird new zealand feces 2022-12-26v31 / 118approvedNo
992amnoncommon port stephens council, research facility, temp 24c, australia, hemolymph, sydney rock oyster, saccostrea glomerata2022-12-27v31 / 118approvedNo
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 119approvedNo
568amnon high in viet nam compared to thailand in gallus gallus chicken feces broiler chicken 2019-12-08v31 / 119approvedNo
743amnoncommon feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v31 / 119approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v41 / 120approvedNo
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 120approvedNo
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v41 / 120approvedNo
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v41 / 120approvedNo
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v41 / 120approvedNo
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v41 / 120approvedNo
777amnon high in 5-year-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 120approvedNo
955amnon high in periodontitis periodontitis compared to control in adult organism subgingival plaque subgingival dental plaque canis lupus familiaris dog chile 2022-12-17v41 / 120approvedNo
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v41 / 121approvedNo
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v41 / 121approvedNo
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v41 / 121approvedNo
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v41 / 121approvedNo
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v41 / 121approvedNo
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v41 / 121approvedNo
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v31 / 121approvedNo
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v41 / 121approvedNo
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v41 / 123approvedNo
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v41 / 123approvedNo
822amnon high in meat diet high protein diet compared to high fiber in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v41 / 123approvedNo
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v41 / 124approvedNo
449amnoncommon homo sapiens, feces, colombia2019-01-09v41 / 124approvedNo
598amnoncommon 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v31 / 124approvedNo
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v41 / 125approvedNo
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v41 / 125approvedNo
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v41 / 125approvedNo
427amnoncommon united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v41 / 125approvedNo
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v41 / 125approvedNo
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 125approvedNo
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v41 / 126approvedNo
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 126approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v31 / 126approvedNo
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 127approvedNo
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 127approvedNo
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v41 / 127approvedNo
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v41 / 127approvedNo
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v41 / 127approvedNo
131amnoncommon homo sapiens, feces, south korea2017-04-16v41 / 128approvedNo
607amnoncommon germany, homo sapiens, feces, control2020-04-19v41 / 128approvedNo
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v41 / 129approvedNo
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v41 / 129approvedNo
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v41 / 129approvedNo
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v41 / 129approvedNo
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v41 / 130approvedNo
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v31 / 130approvedNo
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v41 / 130approvedNo
592amnoncommon wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v11 / 130approvedNo
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in mus musculus mouse feces united states of america )2017-04-14v41 / 131approvedNo
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v31 / 131approvedNo
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v41 / 131approvedNo
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v41 / 132approvedNo
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v41 / 132approvedNo
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v41 / 132approvedNo
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v41 / 132approvedNo
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v41 / 132approvedNo
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v31 / 132approvedNo
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v41 / 132approvedNo
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v41 / 132approvedNo
851amnon high in feces compared to colonic mucosa sigmoid colon brushing sigmoid colon in adult milan italy homo sapiens 2021-12-16v31 / 132approvedNo
246amnoncommon homo sapiens, saliva, italy2017-11-21v41 / 133approvedNo
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v41 / 133approvedNo
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v31 / 133approvedNo
766amnon high in age 8 weeks compared to age 2 days in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v41 / 133approvedNo
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v41 / 133approvedNo
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v41 / 133approvedNo
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v41 / 134approvedNo
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v41 / 134approvedNo
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v41 / 134approvedNo
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v31 / 134approvedNo
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v41 / 134approvedNo
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 134approvedNo
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v41 / 135approvedNo
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v41 / 135approvedNo
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v31 / 135approvedNo
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v41 / 136approvedNo
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v41 / 136approvedNo
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v41 / 136approvedNo
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v41 / 136approvedNo
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v41 / 136approvedNo
997amnoncommon no dental caries, dental black stain, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 136approvedNo
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v41 / 137approvedNo
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v41 / 137approvedNo
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v31 / 137approvedNo
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v31 / 137approvedNo
10amnoncommon homo sapiens, feces, toronto2016-10-27v41 / 138approvedNo
26amnon high in saliva mouth compared to pair of nares mucus in united states of america felis catus 2016-12-05v41 / 138approvedNo
197amnon high in finland compared to india in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v41 / 138approvedNo
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v41 / 139approvedNo
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v41 / 139approvedNo
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v31 / 139approvedNo
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v41 / 140approvedNo
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v41 / 140approvedNo
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 140approvedNo
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v41 / 141approvedNo
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v41 / 141approvedNo
997amnoncommon no dental black stain, no dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 141approvedNo
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v41 / 143approvedNo
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v41 / 144approvedNo
132amnoncommon homo sapiens, feces, united states of america2017-04-16v41 / 145approvedNo
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v41 / 145approvedNo
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v41 / 145approvedNo
822amnoncommon hydrolized diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v41 / 145approvedNo
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 146approvedNo
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v41 / 146approvedNo
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v41 / 146approvedNo
666amnoncommon zoological garden, hippopotamus amphibius, italy, feces2020-09-25v31 / 146approvedNo
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v31 / 146approvedNo
15amnoncommon namibia, feces, canis mesomelas2016-11-08v41 / 147approvedNo
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v41 / 147approvedNo
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v41 / 147approvedNo
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 147approvedNo
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v41 / 147approvedNo
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v41 / 147approvedNo
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v41 / 148approvedNo
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v41 / 148approvedNo
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 148approvedNo
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v41 / 148approvedNo
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in state of minnesota united states of america feces 2021-04-06v41 / 148approvedNo
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v41 / 149approvedNo
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v41 / 149approvedNo
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v41 / 150approvedNo
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v41 / 151approvedNo
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v41 / 151approvedNo
822amnoncommon meat diet, high protein diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v41 / 151approvedNo
889amnon high in woodland yamalo-nenets autonomous okrug compared to nenets autonomous okrug in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v31 / 151approvedNo
997amnoncommon no iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 151approvedNo
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v41 / 152approvedNo
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 152approvedNo
885amnoncommon human early adulthood stage, state of florida, united states of america, feces, homo sapiens2022-03-26v31 / 152approvedNo
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v41 / 153approvedNo
822amnoncommon high fiber, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v41 / 153approvedNo
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v41 / 154approvedNo
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v41 / 154approvedNo
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v41 / 154approvedNo
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v41 / 154approvedNo
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v41 / 154approvedNo
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v41 / 154approvedNo
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v11 / 154approvedNo
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v11 / 154approvedNo
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v41 / 155approvedNo
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v41 / 155approvedNo
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 155approvedNo
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v31 / 155approvedNo
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v31 / 155approvedNo
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v31 / 156approvedNo
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v41 / 157approvedNo
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v41 / 157approvedNo
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in third decade human stage toronto canada adult homo sapiens 2020-09-13v31 / 157approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 157approvedNo
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v41 / 158approvedNo
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v31 / 159approvedNo
994amnoncommon feces, wild, salamandra salamandra, fire salamander, east flanders province, belgium2022-12-27v31 / 159approvedNo
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v41 / 160approvedNo
678amnoncommon control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v31 / 160approvedNo
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v31 / 160approvedNo
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v41 / 161approvedNo
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v41 / 161approvedNo
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v31 / 161approvedNo
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v41 / 162approvedNo
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v41 / 162approvedNo
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v41 / 162approvedNo
26amnoncommon united states of america, felis catus, saliva, mouth2016-12-05v41 / 163approvedNo
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v41 / 163approvedNo
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v31 / 163approvedNo
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v31 / 164approvedNo
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 164approvedNo
955amnoncommon periodontitis, periodontitis, adult organism, subgingival plaque, subgingival dental plaque, canis lupus familiaris, dog, chile2022-12-17v41 / 164approvedNo
906amnoncommon feces, sciurus carolinensis, grey squirrel, province of ontario, canada2022-05-19v41 / 165approvedNo
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v31 / 166approvedNo
658amnon high in asian burmese compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 166approvedNo
961amnon high in 6-year-old human stage compared to 4-year-old human stage in feces homo sapiens child kingdom of denmark zealand 2022-12-20v41 / 166approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v41 / 167approvedNo
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v41 / 168approvedNo
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v41 / 168approvedNo
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v41 / 168approvedNo
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v31 / 168approvedNo
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v41 / 169approvedNo
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v41 / 169approvedNo
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v41 / 169approvedNo
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v31 / 169approvedNo
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 170approvedNo
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v41 / 170approvedNo
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 170approvedNo
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v31 / 170approvedNo
1000amnoncommon control, female, adult, viet nam, homo sapiens, feces2022-12-31v31 / 170approvedNo
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v41 / 171approvedNo
666amnoncommon italy, feces, wood mouse, apodemus sylvaticus2020-09-25v31 / 171approvedNo
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v31 / 172approvedNo
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v41 / 172approvedNo
594amnon high in ngoantet rural community compared to city yaounde in homo sapiens feces cameroon adult 2020-03-12v41 / 172approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v41 / 173approvedNo
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v31 / 174approvedNo
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v41 / 176approvedNo
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v41 / 177approvedNo
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v41 / 178approvedNo
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v41 / 178approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v41 / 179approvedNo
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v41 / 179approvedNo
759amnoncommon city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 179approvedNo
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v41 / 180approvedNo
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v41 / 180approvedNo
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v41 / 180approvedNo
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v41 / 181approvedNo
924amnoncommon guangzhou city prefecture, 8-year-old human stage, 7-year-old human stage, child, supragingival dental plaque, supragingival plaque, china2022-07-27v31 / 181approvedNo
971amnon high in auckland city new zealand compared to helsinki finland in feces overweight body mass index status adult homo sapiens 2022-12-23v31 / 181approvedNo
639amnoncommon lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v31 / 182approvedNo
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 182approvedNo
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v41 / 183approvedNo
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v41 / 183approvedNo
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 184approvedNo
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v41 / 184approvedNo
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v31 / 184approvedNo
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 184approvedNo
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v41 / 185approvedNo
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v41 / 185approvedNo
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v41 / 185approvedNo
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v31 / 185approvedNo
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v41 / 186approvedNo
26amnon high in saliva mouth compared to pair of nares mucus in canis lupus familiaris united states of america 2016-12-05v41 / 187approvedNo
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v41 / 187approvedNo
423amnoncommon bank vole, myodes glareolus, ukraine, feces2018-12-05v41 / 187approvedNo
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v41 / 188approvedNo
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 188approvedNo
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v31 / 188approvedNo
158amnoncommon cat, felis catus, united states of america, saliva, mouth2017-07-06v41 / 189approvedNo
197amnon high in india compared to finland in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v41 / 189approvedNo
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v41 / 190approvedNo
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v41 / 190approvedNo
997amnoncommon iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 190approvedNo
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v41 / 193approvedNo
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v41 / 193approvedNo
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v41 / 193approvedNo
982amnoncommon ulan bator, siberian musk deer, moschus moschiferus, china, mongolia, captive, feces2022-12-25v31 / 193approvedNo
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 194approvedNo
959amnon high in control compared to ulcerative colitis ulcerative colitis in los angeles state of california united states of america adolescent stage 6-12 year-old child stage child feces homo sapiens 2022-12-19v41 / 194approvedNo
826amnoncommon supragingival plaque, supragingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v41 / 195approvedNo
592amnoncommon united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v11 / 196approvedNo
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v41 / 196approvedNo
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v41 / 196approvedNo
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v41 / 197approvedNo
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 197approvedNo
777amnon high in 3-month-old human stage compared to 2-days-old human in infant homo sapiens saliva sweden municipality of umea 2021-04-26v31 / 197approvedNo
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v41 / 198approvedNo
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v41 / 199approvedNo
592amnoncommon feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v11 / 199approvedNo
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v41 / 200approvedNo
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v41 / 200approvedNo
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 200approvedNo
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v41 / 201approvedNo
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v41 / 201approvedNo
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v41 / 201approvedNo
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v31 / 202approvedNo
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v41 / 203approvedNo
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v41 / 203approvedNo
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v41 / 203approvedNo
1021amnoncommon adolescent stage, irkutsk, russia, feces, homo sapiens2023-04-06v31 / 204approvedNo
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v41 / 204approvedNo
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine pasture alpine compared to lowland farm lowland pasture in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v31 / 204approvedNo
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v31 / 205approvedNo
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v31 / 205approvedNo
889amnon high in winter compared to summer in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v31 / 205approvedNo
568amnon high in thailand compared to viet nam in gallus gallus chicken feces broiler chicken 2019-12-08v31 / 206approvedNo
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v31 / 206approvedNo
863amnoncommon qilian county, farm, captive, china, forest musk deer, moschus berezovskii, deer, feces2022-01-28v41 / 206approvedNo
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v41 / 207approvedNo
702amnoncommon equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v41 / 207approvedNo
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v31 / 207approvedNo
927amnoncommon licosa island, italy, podarcis siculus, lizard, feces2022-08-15v31 / 207approvedNo
88amnondifferent between herds in cape buffalo feces ( high in herd croc bridge herd compared to lower sabie herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 208approvedNo
120amnoncommon homo sapiens, feces, brazil2017-04-12v41 / 208approvedNo
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v41 / 208approvedNo
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v41 / 209approvedNo
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v41 / 210approvedNo
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v41 / 211approvedNo
658amnon high in asian burmese compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 212approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 212approvedNo
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v41 / 214approvedNo
826amnoncommon dentition, subgingival plaque, subgingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, research facility, united states of america2021-08-22v41 / 215approvedNo
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v41 / 216approvedNo
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v41 / 216approvedNo
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 217approvedNo
759amnon high in commonwealth of massachusetts city of boston research facility compared to wild state of new york new york city in feces united states of america rattus norvegicus rat 2021-04-06v41 / 217approvedNo
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v41 / 218approvedNo
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v31 / 220approvedNo
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v41 / 221approvedNo
566amnoncommon feces, china, homo sapiens, adult2019-11-24v41 / 221approvedNo
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v31 / 221approvedNo
1006amnoncommon bethesda, research facility, state of maryland, united states of america, captive, vervet monkey, chlorocebus pygerythrus, monkey, feces2023-01-08v41 / 222approvedNo
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v31 / 223approvedNo
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v41 / 224approvedNo
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v41 / 224approvedNo
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v41 / 224approvedNo
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v41 / 225approvedNo
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v11 / 226approvedNo
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v41 / 226approvedNo
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v41 / 227approvedNo
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v41 / 227approvedNo
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v11 / 227approvedNo
927amnon high in licosa island compared to punta licosa in lizard podarcis siculus italy feces 2022-08-15v31 / 227approvedNo
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v41 / 228approvedNo
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v41 / 232approvedNo
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v41 / 232approvedNo
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to 14-year-old human stage 13-year-old human stage child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v31 / 232approvedNo
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v41 / 232approvedNo
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 232approvedNo
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v41 / 232approvedNo
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v31 / 232approvedNo
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v41 / 233approvedNo
826amnoncommon state of illinois, united states of america, saliva, research facility, age 4 years, adult organism, female organism, beagle dog, dog, canis lupus familiaris2021-08-22v41 / 233approvedNo