Summary for ontology term: nouabale-ndoki national park

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGGTGGAGAGGCAAATGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGATTGGCAAGTCAGATGTGAAATGTCGGGGCTTAACCCCGGAACTGCATTTGAAACTGCTGACCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.181818
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTTTAAGATAAAAGCCCGGGGCTCAACTCCGGTTCGTCTTAAAAACTGGTAGACTTGAGTGTGGTAGAGGTAAATGGAATTTCTAGT0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTTAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTGATGGAGAGGCAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGCCCGTCTGGTCGGGAGTCAAAGCCCGGGGCTCAACCCCGGCCCGCTCCCGATACCGGCGGGCTTGAGTCGCGCAGGGGAGGCCGGAATTCCGAGT0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATACCGGGGCTCAACTCCGGAGCTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SlackiaTACGTAGGGGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGCGCGCGCAGGCGGGCTTTCAAGCGGCGGCGTCGAAGCCGGGGGCTCAACCCCCGGAAGCGCCCCGAACTGGAAGCCTCGGATGCGGCAGGGGGAGGCGGAATTCCCGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGTGGTTTGTTAAGTCAGATGTGAAATGTAAGGGCTCAACCCTTAACGTGCATCTGATACTGGCAGACTTGAGTGCGGAAGAGGCAAGTGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.181818

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGCGTGTGTAGGCGGGAAATTAAGTCTAAGGTTTAAGCCCGGAGCTCAACTCCGGTTCGCCTTAGAAACTGATTTTCTTGAGTGTGGTAGAGGCAAACGGAATTTCTAGT0.666667
d__BacteriaCACGTAAGGCGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGTGTAGGCGGCCTGTCAAGTCCCGCGTGAAAGACCGGAGCTCAACTCCGGAGCTGCGCGGGAAACTGGCGGGCTTGAGCCAGCGAAGCGGGACCGGAATTCCTGG0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCCGGTAAGTCAGATGTGAAAAGTGAGGGCTCAACCCTTAGAGTGCATCTGATACTGTCGGGCTTGAGTACAGAAGAGGAAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTCTAAGATCAAAGCCTGGGGCTCAACCCCAGTTCGTCTTAGAAACTGGTAGACTTGAGTGTGGTAGAGGCAAGTGGAATTTCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.666667
d__BacteriaTACATAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTCTGATGTTAAATCCCACAGCTTAACTGTGGGCTGCCATTGGAAACTGGTAGACTTGAGTACGGTAGAGGTAAGTGGAATTCCAAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGGGGGGTGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGTGGTATGTTAAGTCTGGTGTTAAATTCCGAAGCTCAACTTCGGTACGGCACTGGATACTGGCAAACTTGAATGCGGTAGAGGTAAAGGGAATTCCTGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGCTAAGTTGGATGTGAAATACCGGAGCTCAACTCCGGGGCTGCATCCAAAACTGGTTTTCTTGAGTGGAGTAGAGGTAAGCGGAATTCCGAG0.736842
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGCCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGGAACTGTCCAGCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGTAGGTAGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCTTGTTAAGTTTATGGTGAAAGCGTGGGGCTCAACCCCATAAAGCCATAGATACTGGCAAGCTAGAGTACTGGAGAGGGTAGTGGAATTCCATGT0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGTCGGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCCCGAAACCGCCGGGCTCGAGTCCCGCAGGGGATGGCGGAACTCCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGAGCAAGTCTGATGTGAAAACCCGGGGCTTAACCCCGGGCCTGCATTGGAAACTGTTTTTCTGGAGTACTGGAAGGGCAAGCGGAATTCCTGG0.666667
d__BacteriaTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGTTTTTTAAGCACGGGGTTTAAGGCAATGGCTTAACCATTGTTCGCCTTGTGAACTGGAAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTACTGGGCGTAAAGAGTGCGTAGGTGGCTTTTTAAGCGTGAGGTTTAAGGCTATGGCTTAACCATAGTCAGCCTTGCGAACTGGAGAGCTAGAGTACAGGAGAGGAAGGCGGAATTCCTAGT0.588235
d__BacteriaTACGTATGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGGATGTCAAGCGCAGCCTCTAACCTTAGGGCTCAACCTTAAGTCGGGCTGCGAACTGGCATTCTCGAGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.588235
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTGTAGGCGGCTTGTTAAGTCAGGTGTCAAAGCCCGGGGCTCAACCCCGGCCCGCACCTGAAACTGGCAGGCTTGAGTCTGGTAGGGGAAAGTGGAATTCCCAGT0.588235
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTGTAGGCGGCTTGTTAAGTCAGGTGTTAAAGCCTGGGGCTCAACCCCAGCTCGCACCTGAAACTGGCAGGCTTGAGTCTGGTAGGGGAAAGTGGAATTCCCAGT0.588235

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
620amnondominant feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 24
620amnondominant feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 28
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019

Problems / suggestions? Please email info AT dbbact DOT org