Summary for ontology term: obsolete_juvenile stage

Number of annotations with term: 57

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.036364
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTGGAAACTGTTTAACTGGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.036364
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.018182
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCCTGTAAGTCTAGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCCCGGAAACTACAGGGCTAGAGTATCGGAGAGGTGGACGGAACTGCACG0.018182
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.018182
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.018182
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGCTATTTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGTAGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.018182
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.018182
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGAGATTAAGTGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCATACTGGTTTCCTTGAGTACGCACAACGTTGGCGGAATTCGTCG0.018182
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAACTCCGCA0.018182

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.500000
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCAGTTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGCAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGATCGGGAGAGGTTAGAGGTACTCCCA0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.250000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTTGTTCGGTAAGTCAGCGGTGAAACCTGAGCGCTCAACGTTCAGCCTGCCGTTGAAACTGCCGGGCTTGAGTTCAGTGGCGGCAGGCGGAATTCGTGG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTGCGTAGGTGGCGTATTAAGTCAGTGGTGAAAAGCTGCAGCTCAACTGTAGTCTTGCCGTTGAAACTGATATGCTAGAGAGGAGACGAGGTATGCGGAATGTGTGG0.250000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTGAAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAATCACGGAGGGGAAACCGGAATTCCAAG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.135135
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGTAGTGCATTGGAAACTGGAAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.134454
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTAAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGAGGGGATGGAAACTGTTGGTCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.133333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.125523
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTATTCGGAATGACTGGGCGTAAAGCGCACGCAGGCGGTTATTTAAGTCAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTGAAACTGGATAACTAGAATATGTCAGGGGAAGGCGGAATTTCCAG0.123077
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCTGCCCGCTAGGTCCGGGGTCAAATCCGGGGGCTCAACCCCCGCACGCCCCGGATACCGGCGGGCTTGAGTCGGGTAGGGGAAGGCGGAATTCCAGGT0.119048
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.117333
d__BacteriaTACGGAGGACGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGCAGGCGGCCGTGCAAGTCAGCGGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCCGTTGATACTGCATGGCTGGAATGCGGTCGAGGCGGGCGGAACGTGGCG0.115942
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGTCAAGCGGGGTTTCAAATCCAGGGGCTCAACCTCTGGCCGGACCCCGAACTGGCGGGCTCGAGTGCGGTAGAGGAAGGTGGAATTCCCAGT0.115702
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATGGCAAGTCTGATGTGAAAGGCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.113990

Annotations:

common ontology terms
term enrichment score
TermScore
obsolete_juvenile stage0.923077
child0.219780
dairy0.219178
age 30 days0.197531
13-year-old human stage0.148148
jordan0.131148
atlanta0.131148
juvenile organism0.129032
azerbaijan0.123077
age<17 years0.123077
sudan0.115942
venezuela0.115942
amerindian0.115942
omasum0.109589
LOWER IN type i diabetes mellitus0.109589
LOWER IN diabetes mellitus0.109589
type i diabetes mellitus0.109589
diabetes mellitus0.109589
hunter gatherer0.109589
ovis aries0.104575
nigeria0.103896
acute transudative otitis media0.095238
oral cavity0.094675
colon0.090909
middle ear0.090909
adolescent stage0.089888
ruminant reticulum0.086957
state of washington0.086957
LOWER IN obsolete_juvenile stage0.083333
egypt0.080000
finland0.076923
india0.076923
italy0.073733
LOWER IN crohn&#39;s disease0.068966
crohn's disease0.068966
glasgow0.067797
rectum0.066667
dentition0.066390
australia0.066390
mouth0.064257
homo sapiens0.057080
rumen0.051282
immature stage0.040609
feces0.037094
LOWER IN infant0.036697
infant0.036697
caecum0.036364
muc5ac deficient0.033898
LOWER IN muc5ac0.033898
infrequent brushing0.033898
LOWER IN frequenct brushing0.033898
LOWER IN toothbrushing0.033898
toothbrushing0.033898
frequent brushing0.033898
LOWER IN infrequent brushing0.033898
LOWER IN colon0.033333
older age0.033333
LOWER IN younger age0.033333
LOWER IN ruminant reticulum0.032787
LOWER IN omasum0.032787
LOWER IN egypt0.031746
LOWER IN india0.031250
LOWER IN finland0.031250
LOWER IN ulcerative colitis0.030769
ulcerative colitis0.030769
young age0.030303
LOWER IN old age0.030303
LOWER IN rectum0.029412
duodenum0.029412
control0.028103
LOWER IN control0.028103
saliva0.026846
LOWER IN rumen0.025974
LOWER IN age0.025641
age0.025641
united states of america0.022719
male0.022222
LOWER IN male0.022222
LOWER IN caecum0.021505
LOWER IN child0.021505
LOWER IN adult0.018957
adult0.018957
LOWER IN female0.016667
female0.016667
LOWER IN united states of america0.006579
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn&#39;s disease2.000000
crohn's disease2.000000
jordan1.000000
atlanta1.000000
glasgow1.000000
obsolete_juvenile stage0.900000
dairy0.500000
azerbaijan0.500000
age<17 years0.500000
acute transudative otitis media0.500000
muc5ac deficient0.500000
LOWER IN muc5ac0.500000
infrequent brushing0.500000
LOWER IN frequenct brushing0.500000
LOWER IN toothbrushing0.500000
toothbrushing0.500000
frequent brushing0.500000
LOWER IN infrequent brushing0.500000
age 30 days0.333333
colon0.333333
LOWER IN colon0.333333
sudan0.333333
venezuela0.333333
amerindian0.333333
middle ear0.333333
older age0.333333
LOWER IN younger age0.333333
ruminant reticulum0.250000
omasum0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
LOWER IN type i diabetes mellitus0.250000
LOWER IN diabetes mellitus0.250000
type i diabetes mellitus0.250000
diabetes mellitus0.250000
hunter gatherer0.250000
13-year-old human stage0.250000
state of washington0.250000
nigeria0.200000
LOWER IN obsolete_juvenile stage0.200000
egypt0.166667
LOWER IN egypt0.166667
juvenile organism0.166667
finland0.142857
LOWER IN india0.142857
india0.142857
LOWER IN finland0.142857
child0.138889
LOWER IN ulcerative colitis0.125000
adolescent stage0.125000
ulcerative colitis0.125000
young age0.111111
LOWER IN old age0.111111
rectum0.090909
LOWER IN rectum0.090909
duodenum0.090909
ovis aries0.083333
oral cavity0.071429
rumen0.050000
italy0.050000
LOWER IN rumen0.050000
LOWER IN age0.047619
age0.047619
dentition0.043478
australia0.043478
mouth0.041667
LOWER IN infant0.038462
infant0.038462
male0.030303
LOWER IN male0.030303
homo sapiens0.029520
immature stage0.028571
caecum0.027778
LOWER IN caecum0.027778
LOWER IN child0.027778
saliva0.021739
feces0.019108
control0.016216
LOWER IN control0.016216
LOWER IN female0.015873
female0.015873
united states of america0.012146
LOWER IN adult0.011561
adult0.011561
LOWER IN united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
obsolete_juvenile stage0.947368
homo sapiens0.859649
feces0.631579
child0.526316
united states of america0.175439
dairy0.140351
ovis aries0.140351
italy0.140351
age 30 days0.140351
oral cavity0.140351
dentition0.140351
australia0.140351
mouth0.140351
control0.105263
LOWER IN control0.105263
juvenile organism0.105263
13-year-old human stage0.105263
omasum0.070175
jordan0.070175
LOWER IN type i diabetes mellitus0.070175
LOWER IN diabetes mellitus0.070175
type i diabetes mellitus0.070175
diabetes mellitus0.070175
sudan0.070175
azerbaijan0.070175
nigeria0.070175
atlanta0.070175
age<17 years0.070175
immature stage0.070175
adolescent stage0.070175
venezuela0.070175
amerindian0.070175
hunter gatherer0.070175
egypt0.052632
ruminant reticulum0.052632
rumen0.052632
rectum0.052632
caecum0.052632
colon0.052632
LOWER IN adult0.052632
adult0.052632
LOWER IN obsolete_juvenile stage0.052632
finland0.052632
india0.052632
middle ear0.052632
acute transudative otitis media0.052632
state of washington0.052632
LOWER IN crohn&#39;s disease0.035088
crohn's disease0.035088
glasgow0.035088
LOWER IN infant0.035088
infant0.035088
saliva0.035088
LOWER IN united states of america0.017544
LOWER IN egypt0.017544
LOWER IN rectum0.017544
LOWER IN caecum0.017544
LOWER IN colon0.017544
LOWER IN ruminant reticulum0.017544
LOWER IN omasum0.017544
LOWER IN rumen0.017544
duodenum0.017544
LOWER IN ulcerative colitis0.017544
ulcerative colitis0.017544
LOWER IN child0.017544
LOWER IN india0.017544
LOWER IN finland0.017544
muc5ac deficient0.017544
LOWER IN muc5ac0.017544
young age0.017544
LOWER IN age0.017544
LOWER IN old age0.017544
age0.017544
older age0.017544
LOWER IN younger age0.017544
male0.017544
LOWER IN female0.017544
female0.017544
LOWER IN male0.017544
infrequent brushing0.017544
LOWER IN frequenct brushing0.017544
LOWER IN toothbrushing0.017544
toothbrushing0.017544
frequent brushing0.017544
LOWER IN infrequent brushing0.017544
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 1
363amnondominant dairy, omasum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 2
203amnonhigher in kids with frequent toothbrushing ( high in toothbrushing frequent brushing compared to infrequent brushing in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 2
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
203amnon high in male compared to female in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth 2017-10-01v4No1 / 3
285amnonlower in individuals with muc5ac ( high in muc5ac deficient compared to muc5ac in homo sapiens united states of america middle ear acute transudative otitis media child state of washington obsolete_juvenile stage )2018-01-27v4No1 / 4
203amnon high in female compared to male in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth 2017-10-01v4No1 / 4
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 8
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 12
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in infant obsolete_juvenile stage compared to adult in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 16
365amnondominant feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to infant obsolete_juvenile stage in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 17
363amnondominant dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 18
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 19
197amnondominant feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 20
203amnonlower in kids with frequent toothbrushing ( high in infrequent brushing compared to frequenct brushing toothbrushing in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 20
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
203amnondominant homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 21
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
197amnondominant feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 23
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 27
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 28
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
203amnoncommon homo sapiens, oral cavity, dentition, australia, obsolete_juvenile stage, mouth2017-10-01v4No1 / 81
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 189
363amnoncommon dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 302
363amnon high in ruminant reticulum omasum rumen compared to rectum caecum colon in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 360
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422

Problems / suggestions? Please email info AT dbbact DOT org