Summary for ontology term: ocean

Number of annotations with term: 258

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__TenacibaculumTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTTAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTTATACGGAAGTAGATAGAATAAGTAG0.003876
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Alteromonadaceae;g__HalieaTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGTCAGCTGTGAAAGCCCCGGGCTCAACCTGGGAACTGCAGTTGATACTGGCCGACTAGAGTACGAGAGAGGGAGGTAGAATTCCATG0.003876
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.003876
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.003876
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGACTGGAAAGTTGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.003876
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Pseudoalteromonadaceae;g__PseudoalteromonasTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTCGAACTGGCAAACTAGAGTGTGATAGAGGGTGGTAGAATTTCAGG0.003876
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Oceanospirillales;f__Halomonadaceae;g__CobetiaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTAAGTCAGCCAGGTGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATCTGGAACTGCTTGGCTAGAGTGCAGGAGAGGAAGGTAGAATTCCCGG0.003876
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.003876
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__PhotobacteriumTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGCGGTCTGTTAAGCAAGATGTGAAAGCCCGGGGCTCAACCTCGGAACAGCATTTTGAACTGGCAGACTAGAGTCTTGTAGAGGGGGGTAGAATTTCAGG0.003876
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CroceibacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGCCAGATAAGTCAGTGGTGAAATTCCGTGGCTCAACCACGGAACTGCCATTGATACTGTTTGGCTTGAATCAGTTCGAGGATGCCGGAATGTGTGG0.003876

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTTGTTCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACCCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGAGATTAAGTGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCATACTGGTTTCCTTGAGTACGCACAACGTTGGCGGAATTCGTCG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Hyphomonadaceae;g__HelleaTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGATTATTAAGTTAGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTCTAAAACTGGTAATCTAGAGATATGGAGAGGTAAGTGGAATTCCTAG0.345550
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGATCAATAAGTAAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTCTTAAACTGTTGGTCTTGAGTTCTGGAGAGGTGAGTGGAATTGCTAG0.332288
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__PolaribacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCGATTAAGTCAGAGGTGAAATCCCATAGCTCAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTCATATGGAAGTAGATAGAATGTGTAG0.330330
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGATAATTAAGTCAGAGGTGAAATCCTGCAGCTCAACTGTAGAATTGCCTTTGATACTGGTTATCTTGAGTTATTATGAAGTAGTTAGAATATGTAG0.313390
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGAATCACTGGGTTTAAAGGGTGCGTAGGCGGCCTGACAAGTCAGAGGTGAAATACACGAGCTTAACTGGTGAATTGCCTTTGAAACTGTCAAGCTAGAATTATGTTGAGGTTAGCGGAATGAGTCA0.308642
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Acidimicrobiales;f__Acidimicrobiaceae;g__IlumatobacterCACGTAGGCACCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCAGTCAGTCGGGTGTGAAAACTTGAGGCTTAACCTCAAGAGGTCACTCGATACTACTGTGACTAGAGTGCGGTAGGGGAGCGGGGAATTCCTG0.301136
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGCTCAATAAGTCAACTGTTAAATCTTGAAGCTCAACTTCGAAATCGCAGTCGAAACTATTGGACTAGAGTATAGTAGAGGTAAAGGGAATTTCCAG0.299674
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family VIII;g__GpVIIITACGGAGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGTCCGCAGGTGGCTAGTCAAGTCTGCTGTTAAAGACAGAAGCTCAACTTCTGATAGGCAGTGGAAACTGGGTAGCTAGAGTATGGTAGGGGTTGAGGGAATTCCCAG0.296053
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__VibrionaceaeTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTCATTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACTGCATTTGAAACTGGTGAACTAGAGTGCTGTAGAGGGGGGTAGAATTTCAGG0.285714
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__SulfitobacterTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATCAGAAAGTATGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTCATAAACTCCTGGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.278481

Annotations:

common ontology terms
term enrichment score
TermScore
ocean0.965923
pacific ocean0.405145
calvert island0.370732
alga0.345178
coral0.337165
province of british columbia0.270463
marine sediment0.196281
sediment0.191098
oil seep0.169205
skeleton0.167742
mucus0.134969
sea water0.131455
tissue0.113924
canada0.110215
zostera marina0.100358
depth (water) 500-1000m0.090173
north east pacific ocean0.088000
marine eelgrass0.086957
bodega bay0.085106
mastocarpus0.066298
east china sea0.065217
diploastrea heliopora0.058394
depth (water) 1000-2000m0.058394
depth (water) 150-500m0.051471
vancouver0.051471
trichodesmium0.044444
pavona varians0.044444
galaxea astreata0.044444
pocillopora damicornis0.044444
acropora hyacinthus0.044444
porites lobata0.044444
symphyllia0.044444
turbinaria reniformis0.044444
physogyra lichtensteini0.044444
depth (water) 4m0.044444
mastocarpus alaskensis0.044444
carbonate0.044444
lithified carbonate blocks0.044444
hydrate ridge0.044444
atlantic ocean0.044257
stylophora pistillata0.043478
porites cylindrica0.043478
state of california0.041237
state of oregon0.040816
root0.039604
rock0.039216
low tide zone0.037313
high tide zone0.037313
depth (water) 25cm0.037313
depth (water) 2000-3000m0.035971
depth (water) 2000-5000m0.034722
leaf0.032206
depth (water) 1000m0.030075
favites abdita0.030075
seriatopora caliendrum0.030075
fungia0.030075
endocladia0.030075
endocladia muricata0.030075
hildenbrandia0.030075
laminaria0.030075
LOWER IN other regions0.030075
echinopora mammiformis0.029630
biofilm0.025806
red alga0.022727
nereocystis0.022727
kelp0.022727
LOWER IN high tide zone0.022727
LOWER IN low tide zone0.022727
upright gametophyte0.022727
crustose sporophyte0.022727
other regions0.022727
active methane seep0.022727
low activity methane seep0.022727
south china sea0.022472
indian ocean0.022222
coast0.022222
south pacific ocean0.015267
sargasso sea0.015267
depth (water) 2000-4000m0.015267
isopora palifera0.015267
depth (water) 200-2000m0.015267
red sea0.015267
black band disease0.015267
gloiopeltis0.015267
gloiopeltis furcata0.015267
glueweed0.015267
fucus0.015267
fucus distichus0.015267
rockweed0.015267
pseudolithophyllum0.015267
pseudolithophyllum neofarlowii0.015267
turfweed0.015267
pyropia0.015267
pyropia perforata0.015267
purple laver0.015267
analipus0.015267
analipus japonicus0.015267
sea fir0.015267
acrosiphonia0.015267
acrosiphonia coalita0.015267
Fraction of dbbact annotations with this term covered by the query
TermScore
ocean0.937500
mastocarpus0.666667
oil seep0.666667
zostera marina0.666667
marine eelgrass0.666667
south pacific ocean0.500000
trichodesmium0.500000
sargasso sea0.500000
depth (water) 150-500m0.500000
depth (water) 1000m0.500000
depth (water) 2000-4000m0.500000
favites abdita0.500000
skeleton0.500000
seriatopora caliendrum0.500000
pavona varians0.500000
galaxea astreata0.500000
pocillopora damicornis0.500000
acropora hyacinthus0.500000
porites lobata0.500000
symphyllia0.500000
diploastrea heliopora0.500000
isopora palifera0.500000
turbinaria reniformis0.500000
physogyra lichtensteini0.500000
red alga0.500000
LOWER IN nereocystis0.500000
LOWER IN kelp0.500000
vancouver0.500000
nereocystis0.500000
kelp0.500000
LOWER IN red alga0.500000
fungia0.500000
depth (water) 200-2000m0.500000
depth (water) 1000-2000m0.500000
depth (water) 4m0.500000
red sea0.500000
black band disease0.500000
calvert island0.500000
gloiopeltis0.500000
gloiopeltis furcata0.500000
alga0.500000
glueweed0.500000
fucus0.500000
fucus distichus0.500000
rockweed0.500000
pseudolithophyllum0.500000
pseudolithophyllum neofarlowii0.500000
endocladia0.500000
endocladia muricata0.500000
turfweed0.500000
hildenbrandia0.500000
pyropia0.500000
pyropia perforata0.500000
purple laver0.500000
analipus0.500000
analipus japonicus0.500000
sea fir0.500000
acrosiphonia0.500000
acrosiphonia coalita0.500000
prionitis0.500000
prionitis sternbergii0.500000
neorhodomela0.500000
neorhodomela larix0.500000
red pine algae0.500000
phylospadix0.500000
surfgrass0.500000
ralfsia sp.4gws0.500000
ralfsia0.500000
corallina vancouveriensis0.500000
corallina0.500000
graceful coral seaweed0.500000
odonthalia floccosa0.500000
odonthalia0.500000
colpomenia0.500000
colpomenia sp. 1peregrina0.500000
antithamnionella floccosa0.500000
antithamnionella0.500000
polyneura latissima0.500000
polyneura0.500000
laminaria setchelli0.500000
laminaria0.500000
mazzaella splendens0.500000
mazzaella0.500000
plocamium violaceum0.500000
plocamium0.500000
egregia menziesii0.500000
egregia0.500000
ptilota filicina0.500000
ptilota0.500000
neogastroclonium subarticulatum0.500000
neogastroclonium0.500000
ulva0.500000
ulva lactuca0.500000
bossiella frondescems0.500000
bossiella0.500000
cryptosiphonia woodii0.500000
cryptosiphonia0.500000
saccharina groenlandica0.500000
saccharina0.500000
codium0.500000
Fraction of annotations for the query sequences containing the term
TermScore
ocean0.996124
pacific ocean0.488372
coral0.341085
canada0.317829
province of british columbia0.294574
calvert island0.294574
alga0.263566
sediment0.178295
marine sediment0.147287
mucus0.127907
sea water0.108527
tissue0.104651
skeleton0.100775
oil seep0.096899
north east pacific ocean0.085271
zostera marina0.054264
depth (water) 500-1000m0.050388
marine eelgrass0.046512
state of california0.046512
bodega bay0.046512
mastocarpus0.034884
east china sea0.034884
china0.034884
diploastrea heliopora0.031008
depth (water) 1000-2000m0.031008
atlantic ocean0.027132
depth (water) 150-500m0.027132
vancouver0.027132
trichodesmium0.023256
pavona varians0.023256
galaxea astreata0.023256
pocillopora damicornis0.023256
acropora hyacinthus0.023256
porites lobata0.023256
symphyllia0.023256
turbinaria reniformis0.023256
physogyra lichtensteini0.023256
stylophora pistillata0.023256
porites cylindrica0.023256
depth (water) 4m0.023256
rock0.023256
north america0.023256
mastocarpus alaskensis0.023256
root0.023256
state of oregon0.023256
carbonate0.023256
lithified carbonate blocks0.023256
hydrate ridge0.023256
low tide zone0.019380
high tide zone0.019380
depth (water) 25cm0.019380
depth (water) 2000-3000m0.019380
depth (water) 2000-5000m0.019380
leaf0.019380
depth (water) 1000m0.015504
favites abdita0.015504
seriatopora caliendrum0.015504
echinopora mammiformis0.015504
fungia0.015504
biofilm0.015504
endocladia0.015504
endocladia muricata0.015504
hildenbrandia0.015504
laminaria0.015504
LOWER IN other regions0.015504
red alga0.011628
nereocystis0.011628
kelp0.011628
indian ocean0.011628
coast0.011628
south china sea0.011628
LOWER IN high tide zone0.011628
LOWER IN low tide zone0.011628
upright gametophyte0.011628
crustose sporophyte0.011628
other regions0.011628
active methane seep0.011628
low activity methane seep0.011628
south pacific ocean0.007752
sargasso sea0.007752
north pacific ocean0.007752
depth (water) 2000-4000m0.007752
isopora palifera0.007752
coral reef0.007752
sediment depth 0-5cm0.007752
debris0.007752
depth (water) 200-2000m0.007752
microbial mat0.007752
red sea0.007752
anthozoa0.007752
black band disease0.007752
disease0.007752
gloiopeltis0.007752
gloiopeltis furcata0.007752
glueweed0.007752
fucus0.007752
fucus distichus0.007752
rockweed0.007752
pseudolithophyllum0.007752
pseudolithophyllum neofarlowii0.007752
Exp. ID User ID Description Date Region Flag Sequences
418amnondominant ocean, skeleton, coral, seriatopora caliendrum2018-12-02v4No1 / 3
418amnondominant ocean, tissue, coral, pavona varians2018-12-02v4No1 / 3
418amnoncommon ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 3
418amnondominant ocean, skeleton, coral, turbinaria reniformis2018-12-02v4No1 / 3
223amnon high in other regions compared to sanmen bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 3
418amnondominant ocean, skeleton, coral, pavona varians2018-12-02v4No1 / 4
418amnoncommon ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 4
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon, depth (water) 500-1000m2019-01-16v4No1 / 4
236amnondominant ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 4
486amnondominant ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 4
418amnoncommon ocean, mucus, coral, favites abdita2018-12-02v4No1 / 5
418amnondominant ocean, tissue, coral, porites lobata2018-12-02v4No1 / 5
418amnondominant ocean, skeleton, coral, diploastrea heliopora2018-12-02v4No1 / 5
418amnondominant ocean, tissue, coral, turbinaria reniformis2018-12-02v4No1 / 5
418amnoncommon ocean, tissue, coral, physogyra lichtensteini2018-12-02v4No1 / 5
418amnondominant ocean, tissue, coral, physogyra lichtensteini2018-12-02v4No1 / 5
545amnondominant ocean, biofilm, atlantic ocean, debris, depth (water) 200-2000m, biofilm, depth (water) 500-1000m, depth (water) 1000-2000m2019-08-04v4No1 / 5
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth (water) 1000-2000m2019-01-16v4No1 / 5
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope, depth (water) 1000-2000m2019-01-16v4No1 / 5
236amnondominant ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 5
418amnondominant ocean, mucus, coral, favites abdita2018-12-02v4No1 / 6
418amnondominant ocean, skeleton, coral, favites abdita2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, pocillopora damicornis2018-12-02v4No1 / 6
418amnondominant ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, diploastrea heliopora2018-12-02v4No1 / 6
418amnoncommon ocean, skeleton, coral, turbinaria reniformis2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, stylophora pistillata2018-12-02v4No1 / 6
418amnondominant ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 6
235amnonhigh freq. in sediment near eelgrass in northern hemisphere (dominant ocean, sediment, marine sediment)2017-11-07v4No1 / 6
136amnondominant ocean, sea water, pacific ocean, north pacific ocean, trichodesmium2017-04-17v4No1 / 7
418amnoncommon ocean, mucus, coral, porites lobata2018-12-02v4No1 / 7
418amnoncommon ocean, tissue, coral, symphyllia2018-12-02v4No1 / 7
418amnondominant ocean, mucus, coral, isopora palifera2018-12-02v4No1 / 7
418amnondominant ocean, mucus, coral, turbinaria reniformis2018-12-02v4No1 / 7
418amnondominant ocean, skeleton, coral, physogyra lichtensteini2018-12-02v4No1 / 7
545amnondominant ocean, sediment, marine sediment, atlantic ocean, depth (water) 1000m, sediment depth 0-5cm2019-08-04v4No1 / 7
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 7
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour, depth (water) 2000-5000m2019-01-16v4No1 / 7
136amnondominant ocean, sea water, pacific ocean, south pacific ocean, trichodesmium2017-04-17v4No1 / 8
418amnondominant ocean, skeleton, coral, galaxea astreata2018-12-02v4No1 / 8
418amnoncommon ocean, mucus, coral, pocillopora damicornis2018-12-02v4No1 / 8
418amnondominant ocean, mucus, coral, porites lobata2018-12-02v4No1 / 8
418amnoncommon ocean, skeleton, coral, porites lobata2018-12-02v4No1 / 8
418amnondominant ocean, tissue, coral, symphyllia2018-12-02v4No1 / 8
418amnoncommon ocean, mucus, coral, diploastrea heliopora2018-12-02v4No1 / 8
418amnondominant ocean, mucus, coral, physogyra lichtensteini2018-12-02v4No1 / 8
418amnondominant ocean, skeleton, coral, stylophora pistillata2018-12-02v4No1 / 8
223amnondominant ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 8
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 8
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin, depth (water) 2000-5000m2019-01-16v4No1 / 8
236amnondominant ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 8
418amnondominant ocean, skeleton, coral, pocillopora damicornis2018-12-02v4No1 / 9
418amnoncommon ocean, tissue, coral, porites lobata2018-12-02v4No1 / 9
418amnoncommon ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 9
418amnondominant ocean, tissue, coral, fungia2018-12-02v4No1 / 9
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 9
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 9
486amnondominant ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 9
418amnondominant ocean, tissue, coral, galaxea astreata2018-12-02v4No1 / 9
418amnoncommon ocean, mucus, coral, acropora hyacinthus2018-12-02v4No1 / 10
418amnondominant ocean, tissue, coral, echinopora mammiformis2018-12-02v4No1 / 10
418amnondominant ocean, coral reef, sediment2018-12-02v4No1 / 10
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw, depth (water) 500-1000m2019-01-16v4No1 / 10
136amnondominant ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 11
418amnondominant ocean, mucus, coral, pocillopora damicornis2018-12-02v4No1 / 11
355amnondominant ocean, surface water, sea water, pacific ocean, canada, province of british columbia, calvert island2018-08-01v4No1 / 11
355amnonhigh freq. in rocks from low tide zone (dominant ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 11
418amnondominant ocean, skeleton, coral, porites cylindrica2018-12-02v4No1 / 11
418amnondominant ocean, mucus, coral, galaxea astreata2018-12-02v4No1 / 11
418amnoncommon ocean, tissue, coral, diploastrea heliopora2018-12-02v4No1 / 12
418amnondominant ocean, mucus, coral, fungia2018-12-02v4No1 / 12
418amnondominant ocean, mucus, coral, porites cylindrica2018-12-02v4No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neorhodomela, neorhodomela larix, red pine algae2018-08-01v4No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria, laminaria yezoensis2018-08-01v4No1 / 12
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 12
235amnonhigh freq. in eelgrass roots (dominant ocean, rhizome, zostera marina, marine eelgrass, root)2017-11-07v4No1 / 12
418amnoncommon ocean, skeleton, coral, symphyllia2018-12-02v4No1 / 13
418amnondominant ocean, mucus, coral, stylophora pistillata2018-12-02v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, polyneura latissima, polyneura2018-08-01v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 13
355amnon high in low tide zone compared to high tide zone in ocean pacific ocean canada province of british columbia calvert island alga endocladia endocladia muricata 2018-08-01v4No1 / 13
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, klamath knoll2019-01-16v4No1 / 13
418amnoncommon ocean, tissue, coral, pocillopora damicornis2018-12-02v4No1 / 14
418amnondominant ocean, mucus, coral, symphyllia2018-12-02v4No1 / 14
418amnondominant ocean, skeleton, coral, symphyllia2018-12-02v4No1 / 14
418amnondominant ocean, mucus, coral, diploastrea heliopora2018-12-02v4No1 / 14
418amnoncommon ocean, tissue, coral, porites cylindrica2018-12-02v4No1 / 14
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, acrosiphonia, acrosiphonia coalita2018-08-01v4No1 / 14
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, codium, codium fragile2018-08-01v4No1 / 14
235amnonhigh freq. in eelgrass leaf (dominant ocean, leaf, zostera marina, eelgrass)2017-11-07v4No1 / 14
138amnonhigh freq. in ocean water depth 1000m (dominant ocean, sea water, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 15
418amnondominant ocean, mucus, coral, seriatopora caliendrum2018-12-02v4No1 / 15
418amnondominant ocean, mucus, coral, pavona varians2018-12-02v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ptilota filicina, ptilota2018-08-01v4No1 / 15
418amnoncommon ocean, tissue, coral, turbinaria reniformis2018-12-02v4No1 / 16
418amnoncommon ocean, tissue, coral, stylophora pistillata2018-12-02v4No1 / 16
318amnondominant ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 16
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 16
138amnonhigh freq. in ocean water depth 2000-4000m (dominant ocean, sea water, pacific ocean, depth (water) 2000-4000m)2017-04-18v4No1 / 17
418amnondominant ocean, skeleton, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, tissue, coral, acropora hyacinthus2018-12-02v4No1 / 17
418amnondominant ocean, mucus, coral, echinopora mammiformis2018-12-02v4No1 / 17
418amnoncommon ocean, mucus, coral, stylophora pistillata2018-12-02v4No1 / 17
433amnondominant ocean, coast, sea water, south china sea, depth (water) 4m2018-12-19v4No1 / 17
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, egregia menziesii, egregia2018-08-01v4No1 / 17
355amnoncommon in rocks from high tide zone (dominant ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 17
418amnoncommon ocean, skeleton, coral, favites abdita2018-12-02v4No1 / 18
418amnoncommon ocean, mucus, coral, isopora palifera2018-12-02v4No1 / 18
318amnondominant ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, antithamnionella floccosa, antithamnionella2018-08-01v4No1 / 18
355amnonhigh freq. in upright gametophyte of mastocarpus algae (dominant ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 18
355amnonhigher in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in crustose sporophyte compared to upright gametophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 18
235amnoncommon in eelgrass leaf (common ocean, leaf, zostera marina, eelgrass)2017-11-07v4No1 / 18
138amnonhigh freq. in ocean water depth 150-500m (dominant ocean, sea water, pacific ocean, depth (water) 150-500m)2017-04-18v4No1 / 19
418amnoncommon ocean, skeleton, coral, pocillopora damicornis2018-12-02v4No1 / 19
418amnoncommon ocean, skeleton, coral, physogyra lichtensteini2018-12-02v4No1 / 19
418amnon high in mucus compared to tissue in ocean coral diploastrea heliopora 2018-12-02v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, fucus, fucus distichus, rockweed2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, hildenbrandia2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, phylospadix, surfgrass2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 19
418amnoncommon ocean, skeleton, coral, seriatopora caliendrum2018-12-02v4No1 / 20
418amnoncommon ocean, mucus, coral, turbinaria reniformis2018-12-02v4No1 / 20
418amnoncommon ocean, skeleton, coral, porites cylindrica2018-12-02v4No1 / 20
445amnondominant ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 20
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 20
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (dominant ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, crustose sporophyte)2018-08-01v4No1 / 20
418amnoncommon ocean, skeleton, coral, stylophora pistillata2018-12-02v4No1 / 21
418amnoncommon ocean, mucus, coral, porites cylindrica2018-12-02v4No1 / 21
433amnondominant ocean, sea water, indian ocean, depth (water) 4m2018-12-19v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, mazzaella splendens, mazzaella2018-08-01v4No1 / 21
355amnon high in low tide zone compared to high tide zone in ocean pacific ocean canada province of british columbia calvert island alga hildenbrandia hildenbrandia sp. 23gws 2018-08-01v4No1 / 21
223amnon high in other regions compared to hangzhou bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 21
236amnondominant ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 21
270amnondominant united states of america, ocean, marine water body, saline water, pacific ocean, state of florida, depth (water) 20m2018-01-09v4No1 / 21
418amnoncommon ocean, mucus, coral, seriatopora caliendrum2018-12-02v4No1 / 22
418amnondominant ocean, mucus, coral, acropora hyacinthus2018-12-02v4No1 / 23
418amnoncommon ocean, mucus, coral, galaxea astreata2018-12-02v4No1 / 24
418amnoncommon ocean, mucus, coral, fungia2018-12-02v4No1 / 24
418amnoncommon ocean, mucus, coral, physogyra lichtensteini2018-12-02v4No1 / 25
418amnoncommon ocean, skeleton, coral, diploastrea heliopora2018-12-02v4No1 / 26
209amnondominant ocean, sea water, north america, depth (water) 25cm2017-10-15v4No1 / 26
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 27
418amnoncommon ocean, tissue, coral, fungia2018-12-02v4No1 / 28
418amnoncommon ocean, tissue, coral, pavona varians2018-12-02v4No1 / 29
355amnon high in high tide zone compared to low tide zone in ocean pacific ocean canada province of british columbia calvert island alga hildenbrandia hildenbrandia sp. 23gws 2018-08-01v4No1 / 29
418amnoncommon ocean, mucus, coral, pavona varians2018-12-02v4No1 / 34
418amnoncommon ocean, mucus, coral, echinopora mammiformis2018-12-02v4No1 / 34
418amnoncommon ocean, mucus, coral, symphyllia2018-12-02v4No1 / 38
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 39
418amnoncommon ocean, skeleton, coral, pavona varians2018-12-02v4No1 / 42
418amnoncommon ocean, skeleton, coral, galaxea astreata2018-12-02v4No1 / 42
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 42
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-02v4No1 / 44
418amnoncommon ocean, tissue, coral, galaxea astreata2018-12-02v4No1 / 44
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria, laminaria yezoensis2018-08-01v4No1 / 61
355amnonlower in rocks from low tide zone compared to high tide zone ( high in high tide zone compared to low tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 62
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, crustose sporophyte)2018-08-01v4No1 / 66
270amnoncommon united states of america, ocean, marine water body, saline water, pacific ocean, state of florida, depth (water) 20m2018-01-09v4No1 / 66
223amnon high in zhoushan island compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 67
355amnon high in high tide zone compared to low tide zone in ocean pacific ocean canada province of british columbia calvert island alga endocladia endocladia muricata 2018-08-01v4No1 / 68
355amnonhigher in rocks from low tide zone compared to high tide zone ( high in low tide zone compared to high tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 74
136amnoncommon ocean, sea water, atlantic ocean, sargasso sea, trichodesmium2017-04-17v4No1 / 81
318amnoncommon ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 86
355amnonlower in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in upright gametophyte compared to crustose sporophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 86
433amnon high in coast south china sea compared to indian ocean in ocean sea water depth (water) 4m 2018-12-19v4No1 / 87
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, fucus, fucus distichus, rockweed2018-08-01v4No1 / 90
223amnon high in hangzhou bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 90
318amnon high in nereocystis kelp compared to mastocarpus red alga in ocean vancouver pacific ocean canada 2018-04-16v4No1 / 94
355amnoncommon ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 94
136amnoncommon ocean, sea water, pacific ocean, north pacific ocean, trichodesmium2017-04-17v4No1 / 103
223amnon high in sanmen bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 110
235amnoncommon in eelgrass roots (common ocean, rhizome, zostera marina, marine eelgrass, root)2017-11-07v4No1 / 116
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v4No1 / 119
136amnoncommon ocean, sea water, pacific ocean, south pacific ocean, trichodesmium2017-04-17v4No1 / 125
355amnoncommon in upright gametophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 129
209amnon high in vancouver pacific ocean compared to atlantic ocean cape cod canal in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 144
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, hildenbrandia2018-08-01v4No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
355amnoncommon in rocks from high tide zone (common ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 148
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, mazzaella splendens, mazzaella2018-08-01v4No1 / 155
486amnoncommon ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 163
209amnon high in atlantic ocean cape cod canal compared to vancouver pacific ocean in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 166
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 200
355amnoncommon in rocks from low tide zone (common ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 206
138amnoncommon in ocean water depth 5m (common ocean, sea water, pacific ocean, depth (water) 5m)2017-04-18v4No1 / 214
433amnoncommon ocean, coast, sea water, south china sea, depth (water) 4m2018-12-19v4No1 / 215
418amnoncommon ocean, coral reef, sediment2018-12-02v4No1 / 216
545amnoncommon ocean, biofilm, atlantic ocean, debris, depth (water) 200-2000m, biofilm, depth (water) 500-1000m, depth (water) 1000-2000m2019-08-04v4No1 / 227
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, antithamnionella floccosa, antithamnionella2018-08-01v4No1 / 235
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
235amnoncommon in sediment near eelgrass in northern hemisphere (common ocean, sediment, marine sediment)2017-11-07v4No1 / 258
355amnoncommon ocean, surface water, sea water, pacific ocean, canada, province of british columbia, calvert island2018-08-01v4No1 / 280
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
433amnon high in indian ocean compared to coast south china sea in ocean sea water depth (water) 4m 2018-12-19v4No1 / 283
236amnon high in leaf compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 287
223amnon high in other regions compared to yushan islands in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 302
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, polyneura latissima, polyneura2018-08-01v4No1 / 305
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, acrosiphonia, acrosiphonia coalita2018-08-01v4No1 / 311
433amnoncommon ocean, sea water, indian ocean, depth (water) 4m2018-12-19v4No1 / 333
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 345
209amnonhigher in whale blow condensate compared to ocean water ( high in respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow compared to ocean sea water depth (water) 25cm in north america )2017-10-15v4No1 / 359
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neorhodomela, neorhodomela larix, red pine algae2018-08-01v4No1 / 364
486amnoncommon ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 371
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 399
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
545amnoncommon ocean, sediment, marine sediment, atlantic ocean, depth (water) 1000m, sediment depth 0-5cm2019-08-04v4No1 / 436
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, codium, codium fragile2018-08-01v4No1 / 436
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
209amnoncommon ocean, sea water, north america, depth (water) 25cm2017-10-15v4No1 / 445
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, egregia menziesii, egregia2018-08-01v4No1 / 472
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
236amnoncommon ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 505
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 535
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw, depth (water) 500-1000m2019-01-16v4No1 / 554
209amnonlower in whale blow condensate compared to ocean water ( high in ocean sea water depth (water) 25cm compared to respiratory airway megaptera novaeangliae humpback whale exhaled air condensate whale blow in north america )2017-10-15v4No1 / 560
138amnoncommon in ocean water depth 1000m (common ocean, sea water, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 566
138amnoncommon in ocean water depth 150-500m (common ocean, sea water, pacific ocean, depth (water) 150-500m)2017-04-18v4No1 / 582
318amnoncommon ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 598
223amnon high in yushan islands compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 619
486amnon high in oil seep active methane seep compared to low activity methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 649
138amnoncommon in ocean water depth 2000-4000m (common ocean, sea water, pacific ocean, depth (water) 2000-4000m)2017-04-18v4No1 / 674
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope, depth (water) 1000-2000m2019-01-16v4No1 / 725
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 758
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, klamath knoll2019-01-16v4No1 / 789
236amnon high in root compared to leaf in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 819
318amnon high in mastocarpus red alga compared to nereocystis kelp in ocean vancouver pacific ocean canada 2018-04-16v4No1 / 827
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin, depth (water) 2000-5000m2019-01-16v4No1 / 878
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon, depth (water) 500-1000m2019-01-16v4No1 / 990
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour, depth (water) 2000-5000m2019-01-16v4No1 / 1205
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth (water) 1000-2000m2019-01-16v4No1 / 1275
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
486amnon high in low activity methane seep compared to oil seep active methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 1791
472amnon high in depth (water) 150-500m depth (water) 500-1000m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1899
236amnoncommon ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 1904
472amnon high in depth (water) 2000-3000m depth (water) 2000-5000m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1923
472amnon high in depth (water) 1000-2000m compared to depth (water) 2000-3000m depth (water) 2000-5000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
236amnon high in sediment marine sediment compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 2745
472amnon high in depth (water) 1000-2000m compared to depth (water) 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000

Problems / suggestions? Please email info AT dbbact DOT org