Summary for ontology term: oslo

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGTGGAATTCGTGG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGTGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGTTTAAGTGGGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAAAGGAGAATTCCTAG0.117647
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCCTATAAGTCAGCGGTGAAATGTTCCGGCTCAACCGGGAAACTGCCGTTGAAACTGTAGAGCTAGAGTCCACAAGAGGTATGCGGAATGCGTGG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTAAGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.100000
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGTTAAGTAAGATAGTGGTGAAATGCCGGGGCTCAACCTCGGAATTGCCATTATGACTATTTAGCTAGAATGATGCAGAGGATAGCGGAATACCCAG0.100000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATGCCAAGTCAGCTGTGAAAACTATGGGCTTAACCCGTAGACTGCAGTTGAAACTGGTATTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG0.095238
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGAGTAGGCGGTCATGCAAGTCATATGTGAAATGTCAGGGCTTAACCTTGGCGCTGCATAAGAAACTGTATGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.090909
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CoprobacillusTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCAATAGAGGTCTGCGGTGAAAGCCTGAAGCTAAACTTCAGTAAGCCGTGGAAACCAAATAGCTAGAGTGCAGTAGAGGATCGTGGAATTCCATGT0.090909
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.090909

Annotations:

common ontology terms
term enrichment score
TermScore
oslo0.666667
age 1 year0.333333
fourth decade human stage0.222222
kingdom of norway0.222222
LOWER IN age 1 year0.200000
LOWER IN fourth decade human stage0.153846
infant0.071429
LOWER IN infant0.062500
adult0.011429
LOWER IN adult0.011173
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
oslo0.500000
age 1 year0.250000
LOWER IN age 1 year0.250000
LOWER IN fourth decade human stage0.142857
fourth decade human stage0.142857
kingdom of norway0.125000
infant0.038462
LOWER IN infant0.038462
LOWER IN adult0.005780
adult0.005780
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
kingdom of norway1.000000
oslo1.000000
infant0.500000
age 1 year0.500000
adult0.500000
fourth decade human stage0.500000
LOWER IN adult0.166667
LOWER IN fourth decade human stage0.166667
LOWER IN infant0.166667
LOWER IN age 1 year0.166667

Problems / suggestions? Please email info AT dbbact DOT org