Summary for ontology term: perianal skin

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGCTTTTCAAGTCAAGGCTTAAAGGCTAACGGCTCAACCGTAGTAAGGCCTTGAAACTGGAGAGCTTGAGTATCGGAGAGGAAAGTGGAATTCCCAG0.250000
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGCTTCAAGTCAGCTGTTAAAGGATGCGGCTTAACCGTGTTATGCAGTTGAGACTGAGGTGCTGGAGTGCCGTAGAGGCAAGTGGAATTCCCAGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__TannerellaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGGCTGTTAAGTCAGCGGTGAAAGTTTGTCGCTTAACGATAAAATTGCCGTTGAAACTGGTAGTCTTGAGTATAGATGAAGTAGGCGGAATGCGTGG0.250000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCTAAATAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTATAGCTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTCAACCATTGTACGCTTTGGAAACTGTTAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTGTTAAGTCAGCGGTGAAAGGTTTAAGCTCAACTTGGACACTGCCGTTGAAACTGGCGAGCTTGAGTGCAAAGGAGGTAGGCGGAATTCGTGG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTTATAAGTCAGTGGTGAAAAGCTGTGGCTCAACCATAGTCTTGCCGTTGAAACTGTGGAGCTTGAGTGCGGATGAGGTAGGCGGAACGCGTAG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTGTTAAGTCAGCGGTGAAAGGTTCGAGCTCAACTTGGACATTGCCGTTGAAACTGGCGAGCTTGAGTGTAGATGAGGTAGGCGGAATGCATGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTCATAAGTCAGTGGTGAAAAGCTGTGGCTCAACCATAGTCTTGCCGTTGAAACTGTGGAGCTTGAGTGCGGATGAGGTAGGCGGAACGCGTAG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicromonosporaceaeGACGTAGGGCGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCGACTGTGAAAACCCGCGGCTCAACCGCGGGCCTGCAGCCGATACGGGCAGGCTAGAGTTCGGTAGGGGAGACTGGAATTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Microbacteriaceae;g__HerbiconiuxTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACTGGAGGCTCAACCTCCAGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCCAGGTAAGTCCGTTCTGAAAGCCCGGGGCTCAACCCCGGGAGGCGGATGGATACTGCTTGGCTCGAGTCCGGAAGAGGCGAGTGGAATTCCCGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTCAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGAGACTGGAATTCCTG0.500000
d__BacteriaTACGTAGGGTCCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGCGGCGGTGCTGGCCCGGCGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCGTCGGGGACCGCACCGCTTGAGGGCGGTAGGGGCTGGTGGAATGCCTGG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__BelnapiaTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCACTGTTAGTCAGGCGTGAAATTCCTGGGCTCAACCTGGGGACTGCGCTTGATACGGCAGAGCTAGAGGATGGAAGAGGCTCGCGGAATTCCCAG0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4TACGTAGGGACCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCGTGGTAAGTCACTTGTGAAATCTCTGAGCTTAACTCAGAACGGCCAAGTGATACTGCTGTGCTAGAGTGCAGAAGGGGCAATCGGAATTCTTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCACGTCGGATGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCAGACTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Kineosporiaceae;g__AngustibacterTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCAGGGCTTAACCCTGGACCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATCGGAATTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGTCTGGCAGGCGATACGGGCATAACTGGAGTGCTGTAGGGGTAACTGGAATTCCTG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__OdoribacterTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTTAGTGGTTAAATGTTTGAGCTAAACTCAATACAGCCATTAATACTGGTAAACTGGAGTTCAGACGAGGTAGGCGGAATAAGTTAA0.666667
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGTGCTATAAGATAGTGGTGAAATGCCGGAGCTCAACTTCGGAATTGCCATTATGACTATAGTGCTAGAATGATGCAGAGGATAGCGGAATACCCAG0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCATTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGAAGGCTTGAGTATGTTTGGGGCAGGCGGAATGCGTGG0.571429
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTAAACAAGTAGGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATTCTAAACTGTGTAACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGCGTTTTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGGCGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGGAGTGAAATGCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.571429
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTGGTAAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTACGAAACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.571429
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCGTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.571429
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTTGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__BarnesiellaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCACGCCAAGTCAGCGGTGAAATTTCCGGGCTCAACCCGGAGTGTGCCGTTGAAACTGGCGAGCTAGAGTTCACAAGAGGCAGGCGGAATGCGTGG0.500000

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN perianal skin0.500000
external acoustic meatus0.250000
ear canal0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
rectum0.090909
LOWER IN rectum0.090909
wild0.041667
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
wild1.000000
santa catalina island1.000000
urocyon littoralis1.000000
urocyon littoralis catalinae1.000000
santa catalina island fox1.000000
rectum0.750000
perianal skin0.750000
external acoustic meatus0.250000
ear canal0.250000
LOWER IN rectum0.250000
LOWER IN perianal skin0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000

Problems / suggestions? Please email info AT dbbact DOT org