Summary for ontology term: periodontitis

Number of annotations with term: 61

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGCAGGCGGGTCGCCAAGCTTGGTAAGAAATACCGGGGCTCAACTCCGGAGCTATATTGAGAACTGGCGAGCTAGAGTTGCCGAAGGGTATCCGGAATTCCGCG0.152542
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTGAAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAATCACGGAGGGGAAACCGGAATTCCAAG0.118644
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGATAGGCAAGCTTGGTGTGAAATGTTACAGCTTAACTGTGAGACAGCATTGAGAACTGCAGATCTTGAATTACTGAAGGGTAACCAGAATTCCACG0.118644
d__BacteriaTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCTATATAAGCGCATGGTGAAAGGCAGAGGCTTAACCACTGTTAGCCTTGCGAACTGTATAGCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTAGT0.118644
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__TannerellaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGGCTGTTAAGTCCGCGGTGAAAGTTTGTCGCTTAACGATAAAATTGCCGTTGAAACTGGTAGTCTTGAGTATAGATGAAGTAGGCGGAATGCGTGG0.101695
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__FilifactorTACGTAGGGGGCAAGCGTTATCCGGAATAACTGGGCGTAAAGGGTGCGCAGGTGGTTTAACAAGTTAGTGGTGAAAGGCATAGGCTCAACCAATGTAAGCCATTAAAACTGTTTAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.101695
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SchwartziaTACGTAGGCGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGACGGTAAGTCTGTCTTAAAAGGCAAGGGCTCAGCCCCTGTAAGGGACAGAAACTATCGTTCTTGAGTGCCGGAGAGGAAAGCGGAATTCCCAGT0.101695
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Bacteroidales"_incertae_sedis;g__PhocaeicolaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGTTTTTTAAGTCAGCTGTCAAATGTATGGGCTCAACCCTTATTATCAGTTGAAACTGTAAGACTTGAGTGCGGTGTGGGTACATGGAATTCGTGGT0.101695
d__BacteriaTACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCCGTTGTGCAAGTCAGAGGTGAAATTGTGGGGCTCAACTCCGCCGCTGCCTTTGAAACTGCATGACTTGAATCCTGTTGCCGTGGGAGGAATGAGTAG0.101695
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGATTCAAGTCAGCTGTAAAAGGATGCGGCTTAACCGTGTTTAGCAGTTGAAACTGGATGACTGGAGTGCTGGAGAGGCAAGTGGAATTCCCAGT0.101695

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.312500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.187500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.187500
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__KingellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTTATTAAGCAAGATGTGAAATCCCCGAGCTTAACTTGGGAACTGCGTTTTGAACTGGTAAGCTAGAGTATGTCAGAGGGGGGTAGAATTCCACG0.187500
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCTAACGGCTCAACCGTTAAACTGCTTGGGAAACTGATAATCTAGAGTAAGGGAGAGGCAGATGGAATTCTTGG0.187500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCAGTGGCTCAACCATTGTAGGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.187500
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCATCGAAGAAGCGAAAGTGACGGTAGGTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.187500

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__FilifactorTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCAACGCCGCGTGAGTGAAGAAGGCATTCGTGTCGTAAAACTCTGTAGTAGGGGAAGAAAGAAATGACAGTACCCTAAAAGAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.288462
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTGAGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTATGATTGAGGAATTTGACAGTAGATCATGAATAAGGATCGGCTAACTACGTGCCAGCAGCCGCGGTC0.255814
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGATAGGCAAGCTTGGTGTGAAATGTTACAGCTTAACTGTGAGACAGCATTGAGAACTGCAGATCTTGAATTACTGAAGGGTAACCAGAATTCCACG0.255814
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__TannerellaTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTACAGGGGAATAAAATGAGATACGTGTATTTTATTGCATGTACCTTGTGAATAAGCATCGGCTAACT0.254902
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGCACGGGACGAAAACCGAGCTTGAGAATATTGAGTTTGGGTGACGGTACCGAGCGAGGAAGCCACGG0.247423
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTGGGGAATATTGGGCAATGGGAGGAATCCTGACCCAGCGACGCCGCGTGAACGATGAAGGCCTTAGGGTTGTAAAGTTCTTTTATGTGGGAAGAAGGAAGTGACGGTACCACATGAATAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.241758
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGTGTGAATGAAGAAGGCCTTAGGGTCGTAAAATTCTGTCCTAAGGGAAGAAAAAGATGACGGTACCTTAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.240964
d__BacteriaTGAGGAATATTTCACAATGAGCGAAAGCTTGATGGAGCAATGCCGCGTGCAGGATGAAGGCCCTCGGGTTGTAAACTGCTTTTATAAGAGAAGATTATGACGGTAACTTATGAATAAGGGACGGCTAACTACGTGCCAGCAGCCGCGGTC0.240000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCGAGAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAGAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.232558
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCACAATGGAGGGAACTCTGATGCAGCAATGCCGCGTGAAGGAAGAAGGTTTTCGGATTGTAAACTTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTATGTGCCAGCAGCCGCGGTA0.227273

Annotations:

common ontology terms
term enrichment score
TermScore
periodontitis0.930851
subgingival plaque0.809717
subgingival dental plaque0.591966
LOWER IN periodontitis0.372671
chronic periodontitis0.283871
mouth0.264706
dentition0.250348
municipality of beijing0.239316
acute pericementitis0.164384
municipality of shanghai0.131868
buccal mucosa0.131868
brazil0.128205
chile0.115942
glasgow0.115942
puerto rico0.103896
LOWER IN control0.101803
periodontal disease0.099174
mouth mucosa0.099174
control0.093723
macaca mulatta0.089888
oral lichen planus0.089552
gingival erosive oral lichen planus0.089552
depth < 3mm0.089552
shallow pocket depth0.089552
deep pocket depth0.089552
depth > 3mm0.089552
state of new york0.086331
cigarette smoking0.085714
non-smoker0.082192
homo sapiens0.079257
adult0.071536
adult organism0.068376
monkey0.066116
LOWER IN acute pericementitis0.061538
induced periodontitis0.061538
LOWER IN induced periodontitis0.061538
age 12-23 years0.061538
periodontal pocket0.061538
moscow0.061538
age 1-7 years0.059701
atlanta0.059701
san diego0.057971
united kingdom0.050955
child0.050209
dog0.048485
russia0.048193
state of california0.047337
saliva0.045627
canis lupus familiaris0.045198
human adult stage0.042403
LOWER IN before therapy0.032258
non-surgical periodontal therapy0.032258
LOWER IN non-surgical periodontal therapy0.032258
before therapy0.032258
germany0.032000
LOWER IN oral lichen planus0.031746
LOWER IN gingival erosive oral lichen planus0.031746
istanbul0.031746
LOWER IN depth &gt; 3mm0.031746
LOWER IN deep pocket depth0.031746
LOWER IN shallow pocket depth0.031746
LOWER IN depth &lt; 3mm0.031746
LOWER IN cigarette smoking0.031250
LOWER IN chronic periodontitis0.031250
10-15-years-old human0.031250
age 5-10 years0.031250
turkey0.031250
LOWER IN non-smoker0.030769
united states of america0.028941
china0.020931
research facility0.011283
Fraction of dbbact annotations with this term covered by the query
TermScore
periodontitis1.076923
LOWER IN before therapy1.000000
non-surgical periodontal therapy1.000000
LOWER IN non-surgical periodontal therapy1.000000
before therapy1.000000
subgingival dental plaque0.833333
subgingival plaque0.800000
LOWER IN periodontitis0.769231
chronic periodontitis0.666667
LOWER IN oral lichen planus0.500000
LOWER IN gingival erosive oral lichen planus0.500000
oral lichen planus0.500000
gingival erosive oral lichen planus0.500000
LOWER IN acute pericementitis0.500000
acute pericementitis0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
age 12-23 years0.500000
chile0.500000
periodontal pocket0.500000
glasgow0.500000
moscow0.500000
istanbul0.500000
depth < 3mm0.500000
LOWER IN depth &gt; 3mm0.500000
LOWER IN deep pocket depth0.500000
shallow pocket depth0.500000
deep pocket depth0.500000
depth > 3mm0.500000
LOWER IN shallow pocket depth0.500000
LOWER IN depth &lt; 3mm0.500000
cigarette smoking0.333333
age 1-7 years0.333333
LOWER IN cigarette smoking0.333333
LOWER IN chronic periodontitis0.333333
atlanta0.333333
10-15-years-old human0.333333
age 5-10 years0.333333
turkey0.333333
LOWER IN non-smoker0.250000
municipality of beijing0.250000
puerto rico0.250000
non-smoker0.250000
san diego0.250000
mouth0.240000
dentition0.217391
municipality of shanghai0.200000
buccal mucosa0.200000
macaca mulatta0.142857
brazil0.105263
periodontal disease0.100000
mouth mucosa0.100000
russia0.090909
state of new york0.076923
adult organism0.071429
monkey0.066667
LOWER IN control0.063158
control0.057895
child0.051282
saliva0.042553
united kingdom0.041667
homo sapiens0.041522
dog0.038462
adult0.037634
state of california0.037037
canis lupus familiaris0.034483
germany0.031250
human adult stage0.027027
united states of america0.015444
china0.010811
research facility0.006173
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.868852
periodontitis0.819672
subgingival plaque0.819672
adult0.721311
subgingival dental plaque0.459016
china0.327869
dentition0.295082
mouth0.295082
LOWER IN control0.262295
control0.245902
LOWER IN periodontitis0.245902
united states of america0.229508
municipality of beijing0.229508
chronic periodontitis0.180328
brazil0.163934
periodontal disease0.098361
human adult stage0.098361
state of new york0.098361
municipality of shanghai0.098361
mouth mucosa0.098361
buccal mucosa0.098361
acute pericementitis0.098361
monkey0.065574
macaca mulatta0.065574
research facility0.065574
puerto rico0.065574
adult organism0.065574
canis lupus familiaris0.065574
dog0.065574
chile0.065574
united kingdom0.065574
glasgow0.065574
state of california0.065574
cigarette smoking0.049180
oral lichen planus0.049180
gingival erosive oral lichen planus0.049180
child0.049180
non-smoker0.049180
saliva0.049180
depth < 3mm0.049180
shallow pocket depth0.049180
deep pocket depth0.049180
depth > 3mm0.049180
LOWER IN acute pericementitis0.032787
age 1-7 years0.032787
induced periodontitis0.032787
LOWER IN induced periodontitis0.032787
age 12-23 years0.032787
san diego0.032787
periodontal pocket0.032787
atlanta0.032787
russia0.032787
moscow0.032787
germany0.032787
LOWER IN non-smoker0.016393
LOWER IN oral lichen planus0.016393
LOWER IN gingival erosive oral lichen planus0.016393
LOWER IN cigarette smoking0.016393
LOWER IN chronic periodontitis0.016393
LOWER IN before therapy0.016393
non-surgical periodontal therapy0.016393
LOWER IN non-surgical periodontal therapy0.016393
before therapy0.016393
10-15-years-old human0.016393
age 5-10 years0.016393
turkey0.016393
istanbul0.016393
LOWER IN depth &gt; 3mm0.016393
LOWER IN deep pocket depth0.016393
LOWER IN shallow pocket depth0.016393
LOWER IN depth &lt; 3mm0.016393
Exp. ID User ID Description Date Region Flag Sequences
725amnon high in control compared to periodontitis acute pericementitis in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 3
104amnon high in control compared to periodontitis in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 3
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
104amnon high in periodontitis compared to control in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 5
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
102amnon high in control compared to periodontitis in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 7
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
998amnon high in non-surgical periodontal therapy compared to before therapy in periodontitis united kingdom glasgow adult subgingival plaque subgingival dental plaque homo sapiens 2022-12-30v3No1 / 9
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
725amnondominant periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
955amnondominant chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism, periodontitis, periodontitis2022-12-17v4No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
998amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, adult, glasgow, united kingdom, periodontitis2022-12-30v3No1 / 20
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 20
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 22
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
955amnon high in control compared to periodontitis periodontitis in chile dog canis lupus familiaris subgingival dental plaque subgingival plaque adult organism 2022-12-17v4No1 / 35
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
378amnon high in deep pocket depth depth > 3mm compared to shallow pocket depth depth < 3mm in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 40
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
96amnon high in periodontitis compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 48
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 52
162amnon high in periodontitis compared to control in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
102amnon high in periodontitis compared to control in homo sapiens atlanta united states of america mouth 2017-04-04v4No1 / 53
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
998amnon high in before therapy compared to non-surgical periodontal therapy in homo sapiens subgingival dental plaque subgingival plaque adult glasgow united kingdom periodontitis 2022-12-30v3No1 / 85
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
998amnoncommon periodontitis, united kingdom, glasgow, adult, subgingival plaque, subgingival dental plaque, homo sapiens2022-12-30v3No1 / 95
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
955amnon high in periodontitis periodontitis compared to control in adult organism subgingival plaque subgingival dental plaque canis lupus familiaris dog chile 2022-12-17v4No1 / 120
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
955amnoncommon periodontitis, periodontitis, adult organism, subgingival plaque, subgingival dental plaque, canis lupus familiaris, dog, chile2022-12-17v4No1 / 164
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240

Problems / suggestions? Please email info AT dbbact DOT org