Summary for ontology term: peru

Number of annotations with term: 38

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTTGGTAAGTTGGATGTGAAATACCCGGGCTTAACTTGGGGGCTGCATCCAATACTGTCGGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.054054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.054054
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTTTAAGATTAAAGCCCGGGGCTCAACTCCGGTAAGTCTTAAAAACTGGTAGACTTGAGTACGGTAGAGGCAAACGGAATTTCTAGT0.054054
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGAAATGCAAGCCTGGCGTGAAATCCCGGGGCTTAACTCCGGGACTGCGCTGGGAACTGCATAACTAGAGTAACTGAGGGGCGGCCGGAATTCCAGG0.054054
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTTTAAGATAAAAGCCCGGGGCTCAACTCCGGTTCGTCTTAAAAACTGGTAGGCTTGAGTGTGGTAGAGGTAAATGGAATTTCTAGT0.054054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGAATGCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAGACTGCATTTGAAACTGTGTTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.054054
d__BacteriaTACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCTGTGCGTCAAGTCAGGGGTGAAATTCCGGGGCTCAACTCCGGGGCTGCCCTTGATACTGTCGCGCTGGAGTGCGGATGCCGCCGGAGGAATGAGTGG0.054054
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGACAAGTTGGTTGTGAAAGCCCTCGGCTCAACTGAGGAACTGCAACCAAAACTATCATTCTTGAGTGCGGGAGAGGAAAGTGGAATTCCTAG0.054054
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTGGATCTTGAGTGTCGGAGGGGCAATCGGAATTCCTAG0.054054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATACCGGGGCTCAACTCCGGAGCTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.054054

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAAGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGTATTGCATTTGAAACTGTTTAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTTATAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCAACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGTTTATTAAGTCAGATGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTGATAAACTAGAGTTTCGTAGAGGGGGGTAGAATTCCAGG0.642857
d__Bacteria;p__"Verrucomicrobia";c__Opitutae;o__Opitutales;f__OpitutaceaeTACAGAGACTGCGAGCGTTATTCGGATTCACTGGGCGTAAAGGGTGCGCAGGCGGTCGTGTGTGTTAGGTGTGAAAGCCCGAGGCTCAACCTCGGAACTGCGCCTAAAACTACACGACTAGAGTATTGGAGAGGGTAGCGGAATTCATGG0.491228
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGGTTATTAAGTCAGGTGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTGATAATCTAGAGTTTCGTAGAGGGGGGTAGAATTCCAGG0.382979
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGCAGGCGGCCTGTTAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGCAGGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.232558
d__BacteriaTACAGAGACTGCGAGCGTTATTCGGATTCACTGGGCGTAAAGGGTGCGTAGGCGGTCGTGTGTGTTAGGTGTGAAAGCCCGAGGCTCAACCTCGGAACTGCGCCTAAAACTACACGACTAGAGTATTGGAGAGGGTAGCGGAATTCATGG0.190476
d__BacteriaAACATAGGTCACGAGCATTATCCGGATTTATTGGGCGTAAAGGAAGCGTAGGCGGGGAGGTTGATCCATTGTTAAAAGCATTTGCTTAACAAATGTGTGCATTGGAGATCGCCTCCCTAGAGTTAATCAGGGGGTACTGGAATTCAATGT0.166667
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGCAGGCGGTAGTAAAAGATTGTGGTTAAAGAATGGAGCTCAACTCCATAATGCCATGATAACTTTACAACTAGAGTGCAGAAGAGGAGAGTGGAATTCCATGT0.146341
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCTAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGTTTATTAAGTCAGATGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTGATAGACTAGAGTTTCGTAGAGGGAGGTAGAATTCCAGG0.146341
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGTTTATTAAGTCAGATGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTAGTAGGCTAGAGTTTCGTAGAGGGGGGTAGAATTCCAGG0.146341
d__Bacteria;p__"Proteobacteria"TACGGAGAGGGCTAGCGTTATTCGGAATCATTGGGCGTAAAGGGCGCGTAGGCGGGTTAGTAAGTTAAAAGTGAAATCCCAAGGCTCAACCTTGGAACTGCTTTTAAAACTGCTAGTCTAGAGATTGAAAGAGGATAGAGGAATTCCTGG0.146341

Annotations:

common ontology terms
term enrichment score
TermScore
peru0.604167
ants0.486486
beach0.190476
santa cruz province0.190476
small village0.173913
age 9-17 years0.173913
teenager0.173913
lima0.146341
tunapuco0.136364
shantytown0.136364
city0.113636
carpenter ant0.095238
myrmelachista0.095238
dolichoderus0.095238
turtle ants0.095238
azteca0.095238
neoponera0.095238
odontomachus0.095238
solenopsis0.095238
LOWER IN small village0.095238
aerosol0.095238
sand0.095238
camponotus0.090909
cephalotes0.090909
pseudomyrmex0.090909
crematogaster0.090909
eciton0.086957
rural community0.084507
air0.064516
pacific ocean0.057971
state of california0.056338
LOWER IN lima0.051282
digestive system0.050343
LOWER IN tunapuco0.050000
el salvador0.050000
LOWER IN shantytown0.050000
LOWER IN el salado0.050000
iga igg negative fraction0.050000
LOWER IN iga igg negative fraction0.050000
state of oklahoma0.048780
LOWER IN state of oklahoma0.048780
iga negative fraction0.046512
LOWER IN iga positive fraction0.046512
iga positive fraction0.046512
LOWER IN iga negative fraction0.046512
LOWER IN peru0.045455
LOWER IN rural community0.040816
LOWER IN city0.034483
homo sapiens0.021390
feces0.018547
united states of america0.015256
adult0.010959
LOWER IN united states of america0.007018
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN lima1.000000
lima1.000000
beach1.000000
santa cruz province1.000000
peru0.500000
carpenter ant0.500000
ants0.500000
myrmelachista0.500000
dolichoderus0.500000
turtle ants0.500000
azteca0.500000
neoponera0.500000
odontomachus0.500000
solenopsis0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
small village0.500000
tunapuco0.500000
el salvador0.500000
LOWER IN shantytown0.500000
shantytown0.500000
LOWER IN el salado0.500000
aerosol0.500000
sand0.500000
iga igg negative fraction0.500000
age 9-17 years0.500000
teenager0.500000
LOWER IN iga igg negative fraction0.500000
camponotus0.333333
cephalotes0.333333
pseudomyrmex0.333333
crematogaster0.333333
state of oklahoma0.333333
LOWER IN state of oklahoma0.333333
eciton0.250000
iga negative fraction0.200000
LOWER IN iga positive fraction0.200000
iga positive fraction0.200000
LOWER IN iga negative fraction0.200000
LOWER IN peru0.166667
city0.100000
LOWER IN rural community0.090909
rural community0.090909
air0.083333
LOWER IN city0.050000
pacific ocean0.040000
state of california0.038462
digestive system0.026316
homo sapiens0.011070
feces0.009554
united states of america0.008097
adult0.005780
LOWER IN united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
peru0.763158
digestive system0.578947
ants0.473684
feces0.315789
homo sapiens0.315789
united states of america0.131579
city0.131579
adult0.105263
small village0.105263
beach0.105263
state of california0.105263
pacific ocean0.105263
santa cruz province0.105263
age 9-17 years0.105263
teenager0.105263
tunapuco0.078947
rural community0.078947
lima0.078947
shantytown0.078947
camponotus0.052632
carpenter ant0.052632
myrmelachista0.052632
dolichoderus0.052632
cephalotes0.052632
turtle ants0.052632
azteca0.052632
pseudomyrmex0.052632
eciton0.052632
neoponera0.052632
odontomachus0.052632
crematogaster0.052632
solenopsis0.052632
LOWER IN small village0.052632
air0.052632
aerosol0.052632
sand0.052632
state of oklahoma0.026316
LOWER IN peru0.026316
LOWER IN tunapuco0.026316
LOWER IN rural community0.026316
LOWER IN united states of america0.026316
LOWER IN city0.026316
LOWER IN state of oklahoma0.026316
el salvador0.026316
LOWER IN lima0.026316
LOWER IN shantytown0.026316
LOWER IN el salado0.026316
iga negative fraction0.026316
iga igg negative fraction0.026316
LOWER IN iga positive fraction0.026316
iga positive fraction0.026316
LOWER IN iga negative fraction0.026316
LOWER IN iga igg negative fraction0.026316
Exp. ID User ID Description Date Region Flag Sequences
184amnoncommon digestive system, peru, ants, dolichoderus2017-08-15v4No1 / 2
184amnoncommon digestive system, peru, cephalotes, turtle ants2017-08-15v4No1 / 2
184amnondominant digestive system, peru, ants, myrmelachista2017-08-15v4No1 / 4
184amnoncommon digestive system, peru, ants, pseudomyrmex2017-08-15v4No1 / 4
184amnoncommon digestive system, peru, camponotus, carpenter ant2017-08-15v4No1 / 5
184amnoncommon digestive system, peru, ants, neoponera2017-08-15v4No1 / 5
184amnoncommon digestive system, peru, ants, solenopsis2017-08-15v4No1 / 5
184amnondominant digestive system, peru, ants, azteca2017-08-15v4No1 / 6
184amnoncommon digestive system, peru, ants, azteca2017-08-15v4No1 / 7
184amnondominant digestive system, peru, ants, crematogaster2017-08-15v4No1 / 7
184amnondominant digestive system, peru, ants, solenopsis2017-08-15v4No1 / 7
184amnondominant digestive system, peru, ants, dolichoderus2017-08-15v4No1 / 8
184amnondominant digestive system, peru, ants, eciton2017-08-15v4No1 / 8
184amnondominant digestive system, peru, ants, neoponera2017-08-15v4No1 / 8
184amnondominant digestive system, peru, ants, odontomachus2017-08-15v4No1 / 8
304amnondominant united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 9
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 10
184amnondominant digestive system, peru, camponotus, carpenter ant2017-08-15v4No1 / 11
184amnondominant digestive system, peru, ants, pseudomyrmex2017-08-15v4No1 / 11
184amnoncommon digestive system, peru, ants, crematogaster2017-08-15v4No1 / 12
184amnoncommon digestive system, peru, ants, myrmelachista2017-08-15v4No1 / 17
184amnondominant digestive system, peru, cephalotes, turtle ants2017-08-15v4No1 / 18
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
184amnoncommon digestive system, peru, ants, eciton2017-08-15v4No1 / 20
184amnoncommon digestive system, peru, ants, odontomachus2017-08-15v4No1 / 20
830amnondominant feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 23
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
830amnoncommon feces, homo sapiens, peru, age 9-17 years, teenager2021-09-10v4No1 / 47
830amnon high in iga negative fraction iga igg negative fraction compared to iga positive fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 52
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 88
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org