Summary for ontology term: ph 3.5

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Verrucomicrobia";c__Spartobacteria;g__Spartobacteria_genera_incertae_sedisTACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGCGCGTAGGCGGCGGGGTAAGTCGGGTGTGAAATCTCAGAGCTCAACTCTGAAACTGCACTCGATACTGCTCTGCTCGAGGACTGGAGAGGAGACTGGAATTCACGG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAACGCTTGTAGGCGGCCACGCCAAGTCGGATGTGAAATCTCCCGGCTCAACTGGGAGGGGTCATCCGATACTGGCGGGCTCGAGGCAGGTAGGGGGAAGCGGAATTCCCG0.400000
d__BacteriaTACGGAGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCGCGAGCAGTCAACGGTGAAAGCCCGGGGCTCAACTCCGGGTCGGCCGTCGATACTCTCGTGCTGGAGCACTGTAGAGGCAGGTGGAATTCCGGG0.400000
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTTGTATAAGTTAGAGGTGAAATCCCCGGGCTTAACCTGGGAACGGCCTTTAAGACTGTATGACTAGAGTAGAGGAGAGGGGAGTGGAATTTCCGG0.400000
d__BacteriaTACGAGGGGTGCAAACGTTATTCGGAATCACTGGGCGTAAAGGGTGCGTAGACGGCAAAATAAGTCAATTATTAAATCTCCTGGCTTAACTAGGAATCTGTGATTGAAACTGATTTGCTTGAGGATGGAAGAGAGAAGTGGAATTCTCGG0.400000
d__BacteriaTACGGAGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCTTTGTAAGTCACTTGTGAAATCCCGGGGCTCAACTCCGGGGCTGCAGGTGAGACTGTGAGGCTAGAGCTCGGTAGAGGCGAGTGGAATTCCCGG0.400000
d__BacteriaTACGTAGGAGACGAGCGTTGTCCGGAGTTACTGGGCGTAAAGGGTGCGCAGGCGGTCCGTCGCGTGGGTGGTGAAATCTCCTGGCTTAACTGGGAGGGGGCCATCCAAACGGGCGGACTTGAGGCGTGGAGAGGGACGTGGAATTCCGGG0.400000
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeGACGAACCGTGCGAACGTTGTTCGGAATCACTGGGCTTAAAGGGCGCGTAGGCGGAGCACCAAGTCCGGGGTGAAATCTTTCGGCTCAACCGGAAAATAGCCTTGGATACTGGTGGTCTGGAGGGTGGTAGGGGCATGTGGAACTTCCGG0.400000
d__BacteriaTACGAAGGGTGCAAGCGTTGCTCGGAATCATTGGGCGTAAAGCGAGCGCGGGTGGTCTTGTAAGTCAGGAGTGAAAGCCCAGGGCTTAACCCTGGAAGTGCTTTTGATACTGCGAGACTTGAATGTGGGAGAGGGTACTAGAATACCTAG0.400000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__Gp1TACGAGGGGGGCGAGCGTTGCTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTGCGGTAAGTCATCGGTGAAATCTCCCGGCTCAACTGGGAGTCTGCCGGCGAAACTGCCGTGCTGGAGGGTGGGAGAGGTGCGTGGAATTCCCGG0.400000

Annotations:

common ontology terms
term enrichment score
TermScore
minas gerais state0.666667
campos rupestres0.666667
ph 3.50.666667
brazil0.100000
soil0.019608
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
brazil0.052632
soil0.009901
Fraction of annotations for the query sequences containing the term
TermScore
soil1.000000
minas gerais state1.000000
campos rupestres1.000000
brazil1.000000
ph 3.51.000000

Problems / suggestions? Please email info AT dbbact DOT org