Summary for ontology term: pig

Number of annotations with term: 91

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.022222
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__SuccinivibrionaceaeTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTCGGGCAAGTAGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCTAAACTGTCCGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.022222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTGTTAAGTCAGCGGTCAAATGTCAGGGCCCAACCTTGGCATGCCGTTGATACTGGCGGCCTTGAGTTCACACAAGGAAGGTGGAATTCGTCGT0.022222
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MitsuokellaTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAGATCAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATGGAAACTGGTCTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.022222
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAGTAAGTCAGTCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATTGAAACTACTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTCTTAAGTCAGGAGTGAAAGGCTACGGCTTAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTTTCTTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGTGAACTGGGAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.022222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGCAAGTCTGATGTGAAAACCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCAAGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.022222

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTATTAAGTCAGCGGTGAAAGCGTGTGGCTCAACCATACAGTTGCCGTTGATACTGGTAGTCTTGAGTGTAAACGAGGTAGGCGGAATGTGATG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAGGCAGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTTTTCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGTCATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTGACCTTGAGTGCGGCAGAGGCAGGCGGAATTCGTGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAGGCAAGTCAGAAGTGAAAGCTCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTCCTACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__FirmicutesTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGGCGGGATAGCAAGTCAGTCGTGAAATGCCGAGGCTTAACCTCGGAGCTGCGATTGAAACTGTTATTCTTGAGTATCGGAGAGGAAAGCGGAATTCCCAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGATGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGTCCTTGAGTGCGGCAGAGGAAGGCGGAATTCGTGG0.666667
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCCGGTAAGTCTGAAGTGAAAGTCCTGGCTTCAAGTTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTCAGTGGAATTCCCAG0.666667
d__Bacteria;p__FirmicutesTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATAGCAAGTCAGGAGTGAAATGCCGATGCTCAACATCGGAACTGCTTTTGAAACTGTTATTCTTGAGTATCGGAGAGGAAAGCGGAATTCCCAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGGGATTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGTTCTCTTGAGTGCGCTGAAAGTGGGCGGAATTTGTGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTCTTATAAGCGTGACGTGAAATGCAGCGGCTCAACCGTATGATGTGCGTCGCGAACTGTGAGACTTGAGTGTATTCGATGTCAGCGGAATTTGTG0.423729
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGTTTTCTTGAGTGCGCGCGACGCAGGCGGAATTCGTGG0.376068
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTGGTAAGCGTGTTGTGAAATGTCGTTGCTCAACAACGTCACTGCAGCGCGAACTGCCGGGCTTGAGTGTGCGGAAAGCGGGCGGAATTTGTGG0.368421
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGTCAAGTCAGTTGTGAAATCCGCGGGCTCAACCTGCGGCCTGCAGTTGAAACTGGCGGTCTTGAGTCCGTTCAGGGATGCTGGAATTCATGG0.350877
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGCCTTGAGTGCGCGGGAGGTAGGCGGAATTCGTGG0.344828
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGCGGTGAAAGGCCCGGGCTCAACCCGGAAAGTGCCGTTGATACTGTGAGGCTGGAATGCGGATGCTGTGGGAGGAATGAGTGG0.336283
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTAAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.330579
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTATTTTAGGGAGGGGTAGAATTCCACG0.327273
d__BacteriaTACGTAGGTAGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCATTTAAGTTCATGGTGAAAGCGTGGGGCTCAACCCCATAAAGCCATGGATACTGGATGGCTGGAGTACTGGAGAGGGTAGTGGAATTCCATGT0.327273
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGTGGCTTGTTAAGTCAGCGGTGAAAGTCAGTGGCTCAACCATTGAATTGCCGTTGAAACTGGCGAGCTTGAGTACGTACGGGGCAGGCGGAATGCGTGG0.321429

Annotations:

common ontology terms
term enrichment score
TermScore
pig0.957332
sus scrofa0.918717
farm0.267516
province of alberta0.235294
state of michigan0.220994
tonsil0.217687
male organism0.189274
age 6 weeks0.173913
ascending colon0.165138
ileum0.146993
caecum0.145038
pregnancy0.132450
female organism0.120401
salmonella enterica subsp. enterica serovar typhimurium0.116505
salmonellosis0.116505
canada0.109966
age 2 months0.104348
adult organism0.103226
belgium0.103226
commonwealth of pennsylvania0.098160
jiangxi province0.094488
colon0.094340
male0.088626
duroc pig0.080808
age 140 days0.080808
jinhua city prefecture0.080808
jinhua pig0.080808
tibet autonomous region0.077670
nanchang city prefecture0.077670
cecal content0.069565
united kingdom0.063953
research facility0.062641
early pregnancy0.061856
late pregnancy0.061856
state of vermont0.061856
age 6-10 weeks0.061856
age 12-19 weeks0.061856
age 1-3 weeks0.061856
suckling0.061856
preweaned0.061856
age 2-4 weeks0.061856
weaned0.061856
corn and soybean diet0.061856
age 4-7 weeks0.061856
left colon0.058252
LOWER IN caecum0.057554
right colon0.056604
jejunum0.056604
age 4 weeks0.056604
feces0.053241
duodenum0.048387
LOWER IN salmonellosis0.042105
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.042105
tylosin phosphate0.042105
LOWER IN tylosin phosphate0.042105
age 8 hours0.042105
sus scrofa domesticus0.042105
china0.041618
province of quebec0.041237
age 1 month0.041237
state of iowa0.041237
age 9 weeks0.041237
nipple0.041237
LOWER IN left colon0.040404
state of tennessee0.039604
LOWER IN jejunum0.039604
LOWER IN right colon0.039604
united states of america0.038405
gastrointestinal system0.038095
LOWER IN ileum0.037383
LOWER IN pig0.037383
LOWER IN duodenum0.035398
vagina0.035398
zoological garden0.033058
antibiotic0.032520
LOWER IN antibiotic0.032520
female0.032345
italy0.030534
diet0.025478
skin0.025478
LOWER IN ascending colon0.021505
first pregnancy0.021505
LOWER IN multiple pregnancies0.021505
multiple pregnancies0.021505
LOWER IN first pregnancy0.021505
LOWER IN tibetan pig0.021505
LOWER IN tibetan swine0.021505
tibetan pig0.021505
tibetan swine0.021505
LOWER IN state of vermont0.021505
LOWER IN late pregnancy0.021505
LOWER IN early pregnancy0.021505
LOWER IN sucram0.021505
sucram0.021505
LOWER IN age 12-19 weeks0.021505
LOWER IN age 6-10 weeks0.021505
LOWER IN age 1-3 weeks0.021505
farm 10.021505
LOWER IN farm 20.021505
farm 20.021505
Fraction of dbbact annotations with this term covered by the query
TermScore
pig0.937500
sus scrofa0.875000
LOWER IN salmonellosis0.500000
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.500000
ascending colon0.500000
province of alberta0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
LOWER IN ascending colon0.500000
early pregnancy0.500000
late pregnancy0.500000
first pregnancy0.500000
LOWER IN multiple pregnancies0.500000
multiple pregnancies0.500000
LOWER IN first pregnancy0.500000
tylosin phosphate0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
tibetan pig0.500000
tibetan swine0.500000
state of vermont0.500000
LOWER IN state of vermont0.500000
LOWER IN tylosin phosphate0.500000
duroc pig0.500000
age 140 days0.500000
LOWER IN late pregnancy0.500000
LOWER IN early pregnancy0.500000
LOWER IN sucram0.500000
sucram0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
sus scrofa domesticus0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN age 2-4 weeks0.500000
province of quebec0.333333
age 1 month0.333333
LOWER IN colon0.333333
colon0.333333
tibet autonomous region0.333333
wild boar0.333333
LOWER IN wild boar0.333333
state of iowa0.333333
age 9 weeks0.333333
nanchang city prefecture0.333333
standard feed0.333333
LOWER IN standard feed0.333333
nipple0.333333
tonsil0.285714
age 2 months0.250000
state of alabama0.250000
LOWER IN state of alabama0.250000
LOWER IN left colon0.250000
left colon0.250000
male organism0.222222
state of michigan0.222222
age 6 weeks0.200000
state of tennessee0.200000
intestinal contents0.200000
LOWER IN intestinal contents0.200000
LOWER IN jejunum0.200000
LOWER IN right colon0.200000
right colon0.200000
jejunum0.200000
LOWER IN age 4 weeks0.200000
age 4 weeks0.200000
farm0.194444
ileum0.187500
pregnancy0.166667
cecal content0.166667
jiangxi province0.166667
female organism0.153846
gastrointestinal system0.142857
LOWER IN ileum0.125000
adult organism0.125000
belgium0.125000
LOWER IN pig0.125000
caecum0.111111
commonwealth of pennsylvania0.111111
LOWER IN male organism0.111111
Fraction of annotations for the query sequences containing the term
TermScore
pig0.978022
sus scrofa0.967033
farm0.428571
research facility0.395604
feces0.373626
united states of america0.373626
state of michigan0.219780
caecum0.208791
china0.197802
canada0.175824
tonsil0.175824
male0.164835
male organism0.164835
age 6 weeks0.153846
province of alberta0.153846
control0.131868
ileum0.120879
united kingdom0.120879
pregnancy0.109890
ascending colon0.098901
female organism0.098901
commonwealth of pennsylvania0.087912
adult organism0.087912
belgium0.087912
salmonella enterica subsp. enterica serovar typhimurium0.065934
salmonellosis0.065934
adult0.065934
age 2 months0.065934
jiangxi province0.065934
colon0.054945
LOWER IN control0.043956
LOWER IN caecum0.043956
tibet autonomous region0.043956
cecal content0.043956
nanchang city prefecture0.043956
duroc pig0.043956
age 140 days0.043956
jinhua city prefecture0.043956
jinhua pig0.043956
early pregnancy0.032967
late pregnancy0.032967
female0.032967
state of vermont0.032967
left colon0.032967
right colon0.032967
duodenum0.032967
jejunum0.032967
age 6-10 weeks0.032967
age 12-19 weeks0.032967
age 1-3 weeks0.032967
age 4 weeks0.032967
suckling0.032967
preweaned0.032967
age 2-4 weeks0.032967
weaned0.032967
corn and soybean diet0.032967
age 4-7 weeks0.032967
LOWER IN salmonellosis0.021978
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.021978
LOWER IN ileum0.021978
province of quebec0.021978
state of tennessee0.021978
zoological garden0.021978
age 1 month0.021978
antibiotic0.021978
tylosin phosphate0.021978
LOWER IN pig0.021978
LOWER IN antibiotic0.021978
LOWER IN tylosin phosphate0.021978
state of iowa0.021978
age 9 weeks0.021978
LOWER IN duodenum0.021978
LOWER IN jejunum0.021978
LOWER IN left colon0.021978
LOWER IN right colon0.021978
diet0.021978
gastrointestinal system0.021978
vagina0.021978
nipple0.021978
skin0.021978
age 8 hours0.021978
italy0.021978
sus scrofa domesticus0.021978
LOWER IN ascending colon0.010989
first pregnancy0.010989
LOWER IN multiple pregnancies0.010989
multiple pregnancies0.010989
LOWER IN first pregnancy0.010989
LOWER IN colon0.010989
LOWER IN tibetan pig0.010989
LOWER IN tibetan swine0.010989
tibetan pig0.010989
tibetan swine0.010989
LOWER IN sus scrofa0.010989
state of alabama0.010989
wild0.010989
wild boar0.010989
LOWER IN farm0.010989
LOWER IN state of vermont0.010989
LOWER IN state of alabama0.010989
Exp. ID User ID Description Date Region Flag Sequences
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to caecum duodenum jejunum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 6
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
700amnon high in caecum compared to colon in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
688amnondominant feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 17
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
256amnondominant caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 19
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
759amnondominant feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 21
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
314amnondominant farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 23
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 29
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 50
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
816amnon high in early pregnancy compared to late pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 83
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 157
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780

Problems / suggestions? Please email info AT dbbact DOT org