Summary for ontology term: plant

Number of annotations with term: 373

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.013661
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTCTTAAGTCGGTGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGGAGTCTCGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.013661
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.013661
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACCAGGTGCTTAACACCTGGCTTGCTTTCGATACGGGCAGACTAGAGGTATGCAGGGGAGAACGGAATTCCTGG0.013661
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__RhizobacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCTATGCAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCATGGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.013661
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGGTCGTTAAGTCAGGGGTGAAATCCCGGAGCTCAACTCCGGAACTGCCTTTGATACTGGCGACCTTGAGGCTGGAAGAGGTTAGTGGAATTCCCAG0.013661
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__AeromicrobiumTACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTAGTCACGTCGGGAGTGAAAACTCAGGGCTCAACCCTGAGCGTGCTTCCGATACGGGCTGACTAGAGGTATGCAGGGGAGAACGGAATTCCTGG0.013661
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__MethylophilaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCTGTTTTGTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAATATGTCAGAGGGGGGTAGAATTCCACG0.013661
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaGACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTTTGTTAAGTCAGGCGTGAAAGCCCTGGGCTCAACCTGGGATGTGCGTTTGATACTGGCAAGCTTGAGTGCAGGAGAGGATGGTGGAATTCCCAG0.013661
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__RhizobiumTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGATCAGTCAGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTGATACTGTCGATCTGGAGTATGGAAGAGGTGAGTGGAATTCCGAG0.010929

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.461538
d__BacteriaGACAGAGGTGCCGAGCGTTAGGCGGAATCACTGGGCTTAAAGCGTGTGTAGGCGGATGGGTAAGTACCTTGTGAAATCCCACGGCTCAACCGTGGAACTGCTTGGTATACTGCTTGTCTTGAGCCACTTAGGGGCAACCGGAACAAACGG0.384615
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__ArenimonasTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTGAGTTAAGTCTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATGGCGATGGATACTGGCTCGCTAGAGTGCGGTAGAGGAGAGTGGAATTCCCGG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACCAGGTGCTTAACACCTGGCTTGCTTTCGATACGGGCAGACTAGAGGTATGCAGGGGAGAACGGAATTCCTGG0.384615
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGCCAACTAAGTCAGACGTGAAATCCCTCGGCTTAACCGGGGAACTGCGTCTGATACTGGATGGCTTGAGTTTGGGAGAGGGACGCGGAATTCCAGG0.384615
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__ArenimonasTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTCGTTAAGTCTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATGGCGATGGATACTGGCGGGCTAGAGTGCGGTAGAGGAGAGTGGAATTCCCGG0.384615
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTACTAAGTCAGACGTGAAATCCCCCGGCTTAACCTGGGAACTGCGTCTGATACTGGAAGGCTTGAGTATGGGAGAGGGATGTAGAATTCCAGG0.384615
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGTGTAGGTGGCTTCCTAAGTCGGTTGTGAAATCCCTGGGCTCAACCTGGGAATTGCAGTCGATACTGGGAAGCTCGAGTTCGGTAGAGGACGGCGGAATTCCCGG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.384615
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTCTGCAAGTCAGGCGTGAAAGCCCCGGGCTTAACCTGGGAATGGCGCTTGAAACTACAGGACTGGAGTATGGCAGAGGGAGGTGGAATTCCACG0.384615

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCGTTTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATGGCCTTCGATACTGGGACGCTTGAGTATGGTAGAGGTTGGTGGAACTGCGAG0.202335
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.196868
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTCCTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGGACTTGAGTGCAGAAGAGGAAAGCGGAATTCCACG0.194489
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__NeorhizobiumTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGAATTGCGAG0.193344
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.192412
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__PantoeaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTTAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGCAGGCTTGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.189831
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACAAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.183150
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.183060
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.182203
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Intrasporangiaceae;g__JanibacterTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGGGGCTCAACCCCGGACTTGCAGTGGGTACGGGCAGACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.180282

Annotations:

common ontology terms
term enrichment score
TermScore
rhizosphere0.299145
leaf0.237472
soil0.226381
plant0.171064
tree0.165781
mangrove0.158025
wheat0.150117
root0.150117
cultivated environment0.146657
depth (soil) 0-20cm0.138451
greenhouse0.136461
populus0.114014
austria0.112224
china0.109379
rice0.100083
state of tennessee0.097363
oryza sativa0.095314
corn0.094645
ocean0.089735
whole body0.089069
cactus0.085320
fertilized soil0.084718
triticum aestivum0.082816
stem0.082391
mexico0.079295
nida basin0.079012
herbivorous beetle0.079012
beetle0.076010
zostera marina0.075853
united states of america0.073898
kandelia candel0.072351
state of rhode island0.069825
mangrove swamp0.069825
kellogg biological station0.069825
mesic type hapludalf0.069825
kalamazoo loam0.069825
marine eelgrass0.066242
state of california0.065672
north china plain0.060453
myrtillocactus geometrizans0.060453
opuntia robusta0.060453
marine sediment0.059940
semi-arid0.058680
farm0.056108
LOWER IN rhizosphere0.055088
state of michigan0.054581
winter0.052367
garlic0.052219
mangrove biome0.052219
poland0.052202
radish0.051546
taxus0.050891
tomato0.050891
bodega bay0.050891
boechera stricta0.050891
hedera hibernica0.050891
ivy0.050891
brassicaceae0.049896
marsh0.049628
state of idaho0.049628
ph 70.047281
solanum lycopersicum0.045147
agricultural feature0.044362
belgium0.044150
germany0.044129
kingdom of denmark0.043197
ph 7-80.042735
ph 6-6.50.041995
soybean0.041558
raphanus sativus0.041131
fragaria x ananassa0.041131
strawberry0.041131
yellow brown soil0.041131
calvert island0.041131
alga0.041131
continuous corn0.041131
canada0.040892
agricultural field0.040568
glycine max0.039900
kenya0.039506
greenhouse soil0.039506
nanjing city prefecture0.039506
province of british columbia0.039506
state of north carolina0.038005
LOWER IN soil0.036989
futian national nature reserve0.036842
commonwealth of virginia0.036613
allium sativum0.036506
LOWER IN other plants0.036176
other plants0.036176
temperate0.036176
foodon product type0.035944
LOWER IN root0.035851
northeast china0.035533
jinxiang county0.031662
chloroplast0.031169
ceratitis capitata0.031169
mediterranean fruit fly0.031169
restored prairie0.031169
miscanthus0.031169
Fraction of dbbact annotations with this term covered by the query
TermScore
garlic1.000000
mangrove biome1.000000
mangrove1.000000
ph 6-6.51.000000
kandelia candel1.000000
qiao nature reserve1.000000
futian national nature reserve1.000000
sonneratia apetala1.000000
LOWER IN qiao nature reserve1.000000
jinxiang county1.000000
LOWER IN low npk fertilizer dose1.000000
high npk fertilizer dose1.000000
LOWER IN high npk fertilizer dose1.000000
low npk fertilizer dose1.000000
rice0.750000
radish0.666667
flower structure0.666667
cactus0.666667
corn0.666667
allium sativum0.666667
olea europaea0.666667
marine eelgrass0.666667
zostera marina0.666667
soybean0.666667
wheat0.600000
root0.600000
fertilized soil0.600000
alpine bog0.500000
plant surface0.500000
sphagnum0.500000
red fescue grass0.500000
festuca rubra0.500000
LOWER IN other plants0.500000
other plants0.500000
LOWER IN festuca rubra0.500000
LOWER IN red fescue grass0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN meadow geranium0.500000
LOWER IN geranium pratense0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
LOWER IN common sainfoin0.500000
LOWER IN onobrychis viciifolia0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
LOWER IN ribwort plantain0.500000
LOWER IN plantago lanceolata0.500000
prunella vulgaris0.500000
woundwort0.500000
LOWER IN woundwort0.500000
LOWER IN prunella vulgaris0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
LOWER IN germander speedwell0.500000
LOWER IN veronica chamaedrys0.500000
taxus0.500000
taxus media0.500000
temperate0.500000
taxus cuspidata0.500000
onion0.500000
cabbage0.500000
ginger0.500000
state of rhode island0.500000
red pepper0.500000
chloroplast0.500000
scallion0.500000
tomato0.500000
slit loam soil0.500000
blossom0.500000
slit loam0.500000
LOWER IN taxus cuspidata0.500000
raphanus sativus0.500000
LOWER IN taxus media0.500000
taxus mairei0.500000
southeast china0.500000
LOWER IN temperate0.500000
composted animal manure0.500000
LOWER IN composted animal manure0.500000
plant cell0.500000
LOWER IN taxus mairei0.500000
LOWER IN southeast china0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
avicennia marina0.500000
sonneratia alba0.500000
rhizophora mucronata0.500000
ceriops tagal0.500000
tsuga canadensis0.500000
eastern hemlock0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
tsuga sieboldii0.500000
southern japanese hemlock0.500000
tsuga chinensis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.284182
soil0.284182
rhizosphere0.281501
china0.246649
plant0.184987
leaf0.158177
depth (soil) 0-20cm0.131367
tree0.104558
cultivated environment0.091153
wheat0.085791
root0.085791
greenhouse0.085791
mangrove0.085791
austria0.075067
germany0.075067
state of tennessee0.064343
populus0.064343
state of california0.058981
whole body0.058981
ocean0.058981
oryza sativa0.053619
rice0.053619
triticum aestivum0.053619
corn0.050938
mexico0.048257
fertilized soil0.045576
stem0.045576
cactus0.045576
farm0.042895
poland0.042895
beetle0.042895
nida basin0.042895
herbivorous beetle0.042895
marine sediment0.040214
zostera marina0.040214
state of rhode island0.037534
foodon product type0.037534
kandelia candel0.037534
mangrove swamp0.037534
state of michigan0.037534
kellogg biological station0.037534
mesic type hapludalf0.037534
kalamazoo loam0.037534
winter0.034853
marine eelgrass0.034853
LOWER IN rhizosphere0.032172
north china plain0.032172
agricultural feature0.032172
brassicaceae0.032172
myrtillocactus geometrizans0.032172
opuntia robusta0.032172
semi-arid0.032172
canada0.029491
taxus0.026810
garlic0.026810
radish0.026810
solanum lycopersicum0.026810
tomato0.026810
mangrove biome0.026810
marsh0.026810
ph 7-80.026810
bodega bay0.026810
agricultural field0.026810
kingdom of denmark0.026810
ph 70.026810
boechera stricta0.026810
state of idaho0.026810
hedera hibernica0.026810
belgium0.026810
ivy0.026810
LOWER IN soil0.024129
research facility0.021448
raphanus sativus0.021448
commonwealth of virginia0.021448
kenya0.021448
state of north carolina0.021448
ph 6-6.50.021448
fragaria x ananassa0.021448
strawberry0.021448
greenhouse soil0.021448
yellow brown soil0.021448
nanjing city prefecture0.021448
province of british columbia0.021448
calvert island0.021448
pacific ocean0.021448
alga0.021448
continuous corn0.021448
glycine max0.021448
soybean0.021448
LOWER IN other plants0.018767
other plants0.018767
northeast china0.018767
temperate0.018767
LOWER IN root0.018767
futian national nature reserve0.018767
allium sativum0.018767
mitochondrion0.016086
chloroplast0.016086
ph 60.016086
larval stage0.016086
Exp. ID User ID Description Date Region Flag Sequences
311amnoncabbage mitochondrial dna (other mitochondrion, brassica, cabbage)2018-04-08v4No1 / 1
311amnonred pepper chloroplast (other red pepper, chloroplast)2018-04-09v4No1 / 1
311amnongarlic chloroplast (other chloroplast, garlic)2018-04-09v4No1 / 1
155amnonhigh freq in soil loosely bound to wheat root (dominant triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 1
321amnonplant mitochondrion (other mitochondrion, plant cell, plant)2018-04-21v4No1 / 1
321amnonplant chloroplast (other plant cell, plant, chloroplast)2018-04-21v4No1 / 1
793amnondominant depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 1
343amnonapple mitochondria (other mitochondrion, malus x domestica, apple)2018-05-28v4No1 / 1
343amnonapple chloroplast (other chloroplast, malus x domestica, apple)2018-05-28v4No1 / 1
917amnondominant ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1
917amnondominant qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1
705amnongarlic mitochondria (other garlic, allium sativum, mitochondrion)2028-04-04v3No1 / 1
361amnondominant leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, nephrolepis cordifolia2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 1
361amnondominant leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 1
296amnonhigh freq. in wheat field soil (dominant soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 1
236amnonmarine eelgrass mitochondria (other zostera marina, mitochondrion, marine eelgrass)2017-11-07v4No1 / 1
155amnonhigh freq in bulk soil in wheat field (dominant triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 1
266amnonplant mitochondria (other plant, brassicaceae)2017-12-18v4No1 / 1
295amnonolive tree chloroplast (other plant chloroplast, chloroplast, olive tree, olea europaea)2018-02-10v4No1 / 1
295amnonolive tree chloroplast (other plant chloroplast, chloroplast, olive tree, olea europaea)2018-02-10v4No1 / 1
311amnononion mitochondrial dna (other allium cepa, onion, mitochondrion)2018-04-08v4No1 / 2
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
171amnondominant soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 2
171amnondominant united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 2
917amnondominant qiao nature reserve, depth (soil) 0-20cm, ph 6-6.5, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 2
917amnondominant depth (soil) 0-20cm, futian national nature reserve, kandelia candel, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
311amnondominant united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 3
793amnondominant depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v3No1 / 3
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
462amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 3
462amnondominant united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 3
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 3
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 3
311amnondominant ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 4
311amnondominant united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 4
311amnondominant united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 4
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 4
793amnondominant depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 4
793amnondominant depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 4
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 4
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 4
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 4
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 4
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 4
1008amnon high in soil compared to rhizosphere in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 2023-01-26v4No1 / 4
309amnondominant rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 5
306amnonincreases after 90 days of fermentation of insiled whole plant corn ( high in fermented corn days 90 compared to fresh corn day 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 5
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 5
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 5
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 5
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 5
1008amnondominant rhizosphere, china, farm, fertilized soil, allium sativum, garlic, jinxiang county, ph 7-82023-01-26v4No1 / 5
311amnonhigh freq. in salted cabbage (dominant cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 6
311amnondominant united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 6
146amnondominant united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 6
346amnonhigh freq. in fruitfly larva grown on peach (dominant larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 6
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
462amnondominant depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 6
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 6
266amnonhigh freq. in roots in SIL garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 6
279amnondominant grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 6
282amnondominant soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 6
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 6
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 6
145amnondominant soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 7
130amnondominant peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 7
309amnondominant rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 8
134amnondominant rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 8
346amnonhigh freq. in fruitfly larva grown on prickly pear (dominant larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, mediterranean fruit fly, ceratitis capitata)2018-06-11v4No1 / 8
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 8
474amnondominant farm, soil, soybean, glycine max, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 8
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
266amnonplant DNA (other plant, brassicaceae)2017-12-18v4No1 / 8
515amnondominant poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 8
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 8
355amnondominant canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
271amnondominant depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
306amnonhigh freq. at whole plant corn at time 0 (dominant zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 9
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 9
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 9
309amnondominant rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 10
309amnondominant rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 10
346amnonhigh freq. in fruitfly larva grown on figs (dominant larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
309amnondominant lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 11
309amnondominant rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 11
146amnondominant united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 11
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
444amnon high in spring compared to winter in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, cheilotoma musciformis2019-04-18v4No1 / 11
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 11
146amnondominant united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 12
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 12
462amnondominant united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
235amnonhigh freq. in eelgrass roots (dominant ocean, rhizome, zostera marina, marine eelgrass, root)2017-11-07v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
266amnonhigh freq. in roots in MAH garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
515amnondominant poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 12
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 12
309amnondominant rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 13
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, polydrusus inustus2019-04-18v4No1 / 13
130amnon high in vaccinium compared to sphagnum in peatland leaf austria plant alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 13
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans, epipremnum aureum2018-08-21v4No1 / 14
361amnoncommon leaf, austria, greenhouse, plant, olea europaea2018-08-21v4No1 / 14
235amnonhigh freq. in eelgrass leaf (dominant ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 14
250amnonhigh freq. in bamboo forest soil (dominant soil, ph 4, bamboo, phyllostachys pubescens, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 14
129amnon high in rhizosphere compared to soil in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 14
129amnonfound INSIDE leaves of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf, leaf interior)2017-04-15v4No1 / 14
432amnondominant united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
346amnoncommon in fruitfly larva grown on figs (common larval stage, body proper, italy, whole body, ficus carica, fig, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
346amnoncommon in fruitfly larva grown on peach (common larval stage, body proper, prunus persica, italy, whole body, peach, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 15
355amnondominant canada, province of british columbia, calvert island, pacific ocean, ocean, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 15
201amnonhigh freq. in decaying Saguaro cactus (dominant mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 15
201amnonhigh freq. in decaying Cardon cactus (dominant mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 15
462amnondominant united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 15
373amnondominant soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 15
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris quatuordecimpunctata2019-04-18v4No1 / 15
893amnondominant silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 16
343amnonhigh freq. in apple flowers (dominant apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 16
128amnondominant hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 16
432amnondominant united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
266amnonhigh freq. on perennial plant leaves (dominant brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 17
501amnondominant costa rica, dipteryx oleifera, tree, botanical fruit food product2019-03-08v4No1 / 17
355amnondominant canada, province of british columbia, calvert island, pacific ocean, ocean, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 18
361amnoncommon leaf, austria, greenhouse, plant, nephrolepis cordifolia2018-08-21v4No1 / 18
235amnoncommon in eelgrass leaf (common ocean, eelgrass, zostera marina, leaf)2017-11-07v4No1 / 18
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, eusomus ovulum2019-04-18v4No1 / 18
128amnondominant hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 18
146amnondominant united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
355amnondominant canada, province of british columbia, calvert island, pacific ocean, ocean, alga, phylospadix, surfgrass2018-08-01v4No1 / 19
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 19
271amnoncommon depth (soil) 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
893amnondominant sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 21
610sheryoHigher in agricultural field soil unamended with straw ( high in soil unamended with straw compared to soil amended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 22
265amnonhigh freq. in tree leaves (dominant canada, province of quebec, tree, leaf)2017-12-11v4No1 / 22
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, argoptochus quadrisignatus2019-04-18v4No1 / 22
432amnondominant united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnondominant united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
346amnoncommon in fruitfly larva grown on prickly pear (common larval stage, body proper, italy, whole body, prickly pear, opuntia ficus indica, ceratitis capitata, mediterranean fruit fly)2018-06-11v4No1 / 23
128amnondominant hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 23
501amnoncommon costa rica, dipteryx oleifera, tree, botanical fruit food product2019-03-08v4No1 / 25
311amnoncommon united states of america, state of rhode island, allium cepa, onion, foodon product type2018-04-09v4No1 / 26
146amnoncommon united states of america, solanum lycopersicum, tomato, blossom, flower structure2017-04-20v4No1 / 26
462amnoncommon united states of america, state of tennessee, populus, tree, leaf, cultivated environment2019-01-13v4No1 / 28
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
1008amnon high in rhizosphere compared to soil in ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 29
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in triticum aestivum wheat soil china )2017-07-02v4No1 / 31
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
361amnoncommon leaf, austria, greenhouse, plant, aloe arborescens, aloe2018-08-21v4No1 / 34
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 34
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
361amnoncommon leaf, austria, greenhouse, plant, musa acuminate2018-08-21v4No1 / 37
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
373amnon high in rhizosphere compared to soil in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 48
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
515amnoncommon poland, whole body, beetle, aphthona venustula, plant, nida basin, herbivorous beetle2019-04-18v4No1 / 54
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
250amnoncommon in bamboo forest soil (common soil, bamboo, phyllostachys pubescens, ph 4, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 60
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
130amnoncommon peatland, leaf, austria, plant, alpine bog, plant surface, sphagnum bog2017-04-15v4No1 / 65
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 73
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 76
361amnoncommon leaf, austria, greenhouse, plant, musa paradisiaca2018-08-21v4No1 / 77
361amnoncommon leaf, austria, greenhouse, plant, beaucarnea recurvata2018-08-21v4No1 / 81
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 81
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, centricnemus leucogrammus2019-04-18v4No1 / 84
311amnoncommon in salted cabbage (common cabbage, united states of america, state of rhode island, foodon product type)2018-04-09v4No1 / 85
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 88
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, dracaena fragrans2018-08-21v4No1 / 100
361amnoncommon leaf, austria, greenhouse, plant, malvaviscus penduliflorus2018-08-21v4No1 / 102
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
373amnon high in soil compared to rhizosphere in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 111
201amnonlower in cactus fly compared to decaying cactus ( high in cactus decaying compared to fly drosophila drosophila nigrospiracula in mexico desert )2017-10-01v4No1 / 114
128amnonhigher in ivy leaves from moor compared to forest ( high in scrubland moor compared to forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 114
235amnoncommon in eelgrass roots (common marine eelgrass, zostera marina, ocean, rhizome, root)2017-11-07v4No1 / 116
361amnoncommon leaf, austria, greenhouse, plant, aechmea eurycorymbus2018-08-21v4No1 / 117
343amnoncommon in apple flowers (common apple, malus x domestica, flower structure, flower, united states of america, state of connecticut)2018-05-28v4No1 / 118
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 122
1008amnon high in high npk fertilizer dose compared to low npk fertilizer dose in rhizosphere ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 123
128amnonhigher in ivy leaves from forest compared to moor ( high in forest ecosystem compared to scrubland moor in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 123
462amnon high in soil compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 131
1008amnon high in low npk fertilizer dose compared to high npk fertilizer dose in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 rhizosphere 2023-01-26v4No1 / 135
893amnoncommon silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 140
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
893amnoncommon sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 142
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
361amnoncommon leaf, austria, greenhouse, plant, dracaena marginata2018-08-21v4No1 / 146
361amnoncommon leaf, austria, greenhouse, plant, howea forsteriana2018-08-21v4No1 / 154
361amnoncommon leaf, austria, greenhouse, plant, dracaena draco2018-08-21v4No1 / 155
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
266amnoncommon on perennial plant leaves (common brassicaceae, boechera stricta, plant, leaf, united states of america, state of idaho)2017-12-19v4No1 / 156
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
311amnoncommon ginger, united states of america, state of rhode island, foodon product type2018-04-09v4No1 / 180
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
201amnoncommon in decaying Saguaro cactus (common mexico, desert, carnegiea gigantea, saguaro, cactus, decaying)2017-10-01v4No1 / 193
201amnoncommon in decaying Cardon cactus (common mexico, desert, cactus, decaying, pachycereus pringlei, cardon)2017-10-01v4No1 / 193
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 200
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
201amnonhigher in cactus fly compared to decaying cactus ( high in drosophila fly drosophila nigrospiracula compared to cactus decaying in mexico desert )2017-10-01v4No1 / 215
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
130amnon high in sphagnum compared to vaccinium in peatland leaf plant austria alpine bog plant surface sphagnum bog 2017-04-15v4No1 / 222
265amnoncommon in tree leaves (common canada, province of quebec, tree, leaf)2017-12-11v4No1 / 226
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 254
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
309amnon high in other plants compared to meadow geranium geranium pratense in rhizosphere germany 2018-04-05v4No1 / 267
361amnoncommon leaf, austria, greenhouse, plant, chlorophytum comosum2018-08-21v4No1 / 270
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
236amnon high in leaf compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 287
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 287
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 288
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
309amnon high in other plants compared to ribwort plantain plantago lanceolata in rhizosphere germany 2018-04-05v4No1 / 352
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v4No1 / 383
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v4No1 / 404
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, leaf2017-11-07v4No1 / 505
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in hedera hibernica belgium ivy leaf )2017-04-14v4No1 / 525
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 543
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v4No1 / 550
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree leaf cultivated environment 2019-01-13v4No1 / 559
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, leaf2017-04-15v4No1 / 562
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
128amnoncommon hedera hibernica, belgium, ivy, leaf, moor, scrubland2017-04-14v4No1 / 623
793amnoncommon depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 662
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
309amnon high in lathyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
128amnoncommon hedera hibernica, belgium, ivy, leaf, forest ecosystem2017-04-14v4No1 / 693
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
793amnoncommon depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 733
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 819
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
793amnoncommon depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 900
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 930
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
917amnon high in qiao nature reserve compared to futian national nature reserve in mangrove biome mangrove depth (soil) 0-20cm china marsh soil saline marsh 2022-07-08v3No1 / 967
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
793amnoncommon depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v3No1 / 1001
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
917amnon high in futian national nature reserve compared to qiao nature reserve in depth (soil) 0-20cm china marsh mangrove mangrove biome soil saline marsh 2022-07-08v3No1 / 1071
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
171amnon high in control compared to drought environment in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 1164
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, sediment, marine sediment2017-11-07v4No1 / 1904
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org