Summary for ontology term: pregnancy

Number of annotations with term: 49

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.040816
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGGTTTTCGAATCGTAAAGCTCTGTCCTATGAGAAGATAATGACGGTATCATAGGAGGAAGCCCCGGCTAAATACGTGCCAGCAGCCGCGGTA0.020408
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAACGAAGAAGGTCTTCGGATTGTAAAGTTCTGTGATTCGGGACGAAAGGGTTTGTGGTGAATAATCATAGACATTGACGGTACCGAAAAAGCAAGCCACGG0.020408
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.020408
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGTCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAGGAAGGCCTTGCCTGTGTGGTGGGGTTGACGGTAGCTGGGTTAATTGAAGCGCCGGCTA0.020408
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGGATTTTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTGTCGCCGGTGATGTAGGCTCTGCTTTGTGGGTGGGGTTGACGGTAGCCGGGGTATGAAGTGCCGGCTAAC0.020408
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGATGAAGGCCTTCGGGTTGTAAAGCACTTTTGGCGGGAACGAAAAGGACCGTGCCAATACCATGGTCTGATGACGGTACCCGCAGAATAAGCACCGGC0.020408
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAAGGAAGAACGAGTGTGAGAATGGAAAGTTCATACTGTGACGGTACTTAACCAGAAAGGGACGG0.020408
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGCACGGGACGAAAACCGAGCTTGAGAATATTGAGTTTGGGTGACGGTACCGAGCGAGGAAGCCACGG0.020408
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__ShuttleworthiaTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGTGAGGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAGAAATGACGGTACCTGAGTAAGAAGCTCCGGCTAAATACGTGCCAGCAGCCGCG0.020408

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTGAGGAATATTGGACAATGGGTGGAAGCCTGATCCAGCCATCCCGCGTGCAGGACGACTGCCCTATGGGTTGTAAACTGCTTTTATATAGGGATAAACCTACTCTCGTGAGAGTAGCTGAAGGTACTATATGAATAAGCACCGGCTAACT0.500000
d__Bacteria;p__FirmicutesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGGGAAGACGGTTTTCGGATTGTAAACCTCTGTTTTCGGTGACGAACAAATGACGGTAACCGAGTAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGGATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGCATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__SneathiaTGGGGAATATTGGACAATGGAGGGAACTCTGATCCAGCAATTCTGTGTGTGTGAAGAAGGTTTTAGGACTGTAAAACACTTTTAGTAGGGAAGAAAAAAATGACGGTACCTACAGAAGAAGCAACGGCTAAATACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATATGGGAATAAAGTGAGGGACGTGTCCCTTATTGCATGTACCATACGAATAAGGACCGGCTAATT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCCTTGCAAGTCAGCGGTCAAATCGTGGAGCTCAACTCCATTCCGCCGTTGATACTGCCGGGCTTGATTGCGGTTGAGGTTTGCGGAATTCGTCGT0.222222
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTTTGCAAGCTTGATGTGAAAGGCAGGAGCTTAACTCCTGGACTGCGTTGAGAACTGCATGACTGGAGTCACTGAGGGGCAATCAGAATTCCTGG0.214286
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGTGTAGGCGGGAATTTAAGTCAGATGTGAAAGACCCGGGCTCAACTTGGGGATTGCATTTGATACTGGATTTCTTGAGGACAGGAGAGGAAAGCGGAATTCCTAG0.178571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XIIITACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCAGGGGGTGAAAGGCAATGGCTTAACCATTGTTAGCCCCCTGAACTGGGCTACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.172414
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACCCGGGCTTAACCTGGGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.172043
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCCTTGCAAGTCAGCGGTCAAATCGTGGAGCTCAACTCCATTCCGCCGTTGATACTGCCGGGCTTGATTGCGGTTGAGGTTTGCGGAATTCGTTGT0.169492
d__Bacteria;p__"Bacteroidetes"TACGGAGGATTCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTAGATAAGTTTGAGGTTAAATGCTTCTGCTCAACAGGAGTTTGCCTTGAAAACTGTCTGACTAGGATGTAAACGGCGCAGGCGGAATGAATCAT0.161290
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTATCTAAGCTTGGTGTGAAAGGCAGGGGCTCAACTCCTGGACTGCATTGAGAACTGGATAACTAGAGTTACTGAAGTGAAATCAGAATTCCAGG0.160000
d__BacteriaCACGTAAGCCTCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGAATTGCAAGCTTGATGTGAAAGGCAGGGGCTTAACTCCTGGATTGCGTTGAGAACTGCATAACTAGAGTAACTGAGGGGCAGCCGGAATTCCAGG0.158730
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGGGAGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.156250

Annotations:

common ontology terms
term enrichment score
TermScore
pregnancy0.979167
female0.298725
third trimester0.280702
vagina0.279070
gestational diabetes0.253165
female organism0.190476
turin township0.169492
nanjing city prefecture0.164384
sus scrofa0.155039
pig0.155039
ismailia0.140351
digesta0.131868
age 25-45 years0.131148
commonwealth of pennsylvania0.124031
first trimester0.112150
egypt0.109589
pregnancy trimester 20.109091
early pregnancy0.109091
late pregnancy0.109091
sheep0.104348
restricted feed0.103448
adult organism0.099379
ovis aries0.094488
non-pregnant0.078431
LOWER IN non-pregnant0.078431
gestational age 8-12 weeks0.075472
chengdu city prefecture0.075472
second trimester0.075472
urine0.074074
state of tennessee0.074074
province of quebec0.072727
adult0.069682
japan0.068376
human early adulthood stage0.068376
israel0.068376
LOWER IN pregnancy0.064516
rumen0.064171
italy0.062893
homo sapiens0.059362
human adult stage0.042735
LOWER IN pregnancy trimester 20.039216
african0.039216
LOWER IN african0.039216
LOWER IN late pregnancy0.039216
LOWER IN early pregnancy0.039216
LOWER IN multiple pregnancies0.039216
first pregnancy0.039216
LOWER IN first pregnancy0.039216
multiple pregnancies0.039216
LOWER IN second trimester0.039216
LOWER IN last trimester0.039216
last trimerster0.039216
premature birth0.039216
LOWER IN premature birth0.039216
LOWER IN third trimester0.038462
LOWER IN first trimester0.038462
LOWER IN restricted feed0.038462
LOWER IN caucasian0.037736
african american0.037736
caucasian0.037736
LOWER IN african american0.037736
canada0.036697
saliva0.033755
feces0.033540
farm0.032520
china0.030045
research facility0.023669
united states of america0.022458
control0.018648
LOWER IN control0.016736
Fraction of dbbact annotations with this term covered by the query
TermScore
non-pregnant1.000000
LOWER IN non-pregnant1.000000
pregnancy1.000000
third trimester1.000000
first trimester0.666667
LOWER IN pregnancy trimester 20.500000
ismailia0.500000
pregnancy trimester 20.500000
african0.500000
LOWER IN african0.500000
gestational age 8-12 weeks0.500000
chengdu city prefecture0.500000
LOWER IN late pregnancy0.500000
early pregnancy0.500000
LOWER IN early pregnancy0.500000
late pregnancy0.500000
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
turin township0.500000
LOWER IN second trimester0.500000
second trimester0.500000
LOWER IN last trimester0.500000
last trimerster0.500000
premature birth0.500000
LOWER IN premature birth0.500000
urine0.400000
state of tennessee0.400000
age 25-45 years0.333333
province of quebec0.333333
gestational diabetes0.333333
LOWER IN third trimester0.333333
LOWER IN first trimester0.333333
restricted feed0.333333
LOWER IN restricted feed0.333333
vagina0.272727
LOWER IN caucasian0.250000
african american0.250000
caucasian0.250000
LOWER IN african american0.250000
nanjing city prefecture0.250000
female0.181818
egypt0.166667
LOWER IN pregnancy0.153846
female organism0.142857
digesta0.142857
sus scrofa0.125000
pig0.125000
commonwealth of pennsylvania0.100000
sheep0.090909
ovis aries0.076923
adult organism0.071429
japan0.058824
human early adulthood stage0.058824
israel0.058824
italy0.045455
rumen0.043478
adult0.037634
canada0.033333
homo sapiens0.031142
farm0.027027
human adult stage0.027027
saliva0.021277
feces0.017391
china0.016216
research facility0.012346
united states of america0.011583
LOWER IN control0.010526
control0.010526
Fraction of annotations for the query sequences containing the term
TermScore
pregnancy0.959184
female0.836735
homo sapiens0.632653
adult0.469388
feces0.469388
united states of america0.367347
vagina0.285714
research facility0.285714
female organism0.285714
sus scrofa0.204082
pig0.204082
china0.204082
gestational diabetes0.204082
commonwealth of pennsylvania0.163265
adult organism0.163265
third trimester0.163265
nanjing city prefecture0.122449
digesta0.122449
rumen0.122449
sheep0.122449
ovis aries0.122449
human adult stage0.102041
turin township0.102041
italy0.102041
age 25-45 years0.081633
ismailia0.081633
egypt0.081633
japan0.081633
human early adulthood stage0.081633
saliva0.081633
control0.081633
israel0.081633
pregnancy trimester 20.061224
early pregnancy0.061224
late pregnancy0.061224
first trimester0.061224
restricted feed0.061224
LOWER IN pregnancy0.040816
non-pregnant0.040816
LOWER IN non-pregnant0.040816
urine0.040816
state of tennessee0.040816
canada0.040816
farm0.040816
province of quebec0.040816
gestational age 8-12 weeks0.040816
chengdu city prefecture0.040816
second trimester0.040816
LOWER IN control0.040816
LOWER IN pregnancy trimester 20.020408
LOWER IN caucasian0.020408
african american0.020408
african0.020408
caucasian0.020408
LOWER IN african0.020408
LOWER IN african american0.020408
LOWER IN late pregnancy0.020408
LOWER IN early pregnancy0.020408
LOWER IN multiple pregnancies0.020408
first pregnancy0.020408
LOWER IN first pregnancy0.020408
multiple pregnancies0.020408
LOWER IN second trimester0.020408
LOWER IN third trimester0.020408
LOWER IN last trimester0.020408
last trimerster0.020408
LOWER IN first trimester0.020408
premature birth0.020408
LOWER IN premature birth0.020408
LOWER IN restricted feed0.020408
Exp. ID User ID Description Date Region Flag Sequences
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
528amnoncommon homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 5
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 7
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
191amnondominant homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 11
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 14
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
528amnondominant homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 17
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 19
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v3No1 / 21
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 22
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 31
528amnon high in african american african compared to caucasian in united states of america pregnancy vagina female homo sapiens 2019-07-14v1No1 / 34
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 85
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780

Problems / suggestions? Please email info AT dbbact DOT org