Summary for ontology term: puerto rico

Number of annotations with term: 31

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTGTTAAGTCAGCGGTCAAATGTCAGGGCCCAACCTTGGCATGCCGTTGATACTGGTGGTCTTGAATTCACACAAGGAAGGTGGAATTCGTCGT0.518519
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTCAAAGGCTGTGGCTCAACCATAGTTTGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.489796
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGTGTAGGCGGTCCGTTAAGCGTGTTGTGAAATTTAGATGCTCAACATCTGACTTGCAGCGCGAACTGGTGGACTTGAGTGCACGCAACGTATGCGGAATTCATGG0.482759
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAATAGCATTTCATACTGGGTTGCTAGAGTATTTTAGGGAGGGGTAGAATTCCACG0.461538
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.454545
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__AlloscardoviaTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCTGGGTACGGGCAGGCTAGAGTGTAGTAGGGGAGACTGGAATTCCCGG0.451613
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTCTTTAAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGAAGGACTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.450000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.439024
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTAATTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGGTTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.437500
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCTCGGAACTGCTTTGGAAACTGTTAAGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCCAG0.424242

Annotations:

common ontology terms
term enrichment score
TermScore
puerto rico1.200000
cayo santiago0.537313
indian rhesus macaque0.537313
macaca mulatta0.486957
age 10-15 years0.279070
age > 1 year0.279070
age < 1 year0.244898
age 12-23 years0.243902
age 1-7 years0.217391
rectal swab0.196721
isla palominos0.162162
acropora cervicornis0.162162
adult organism0.151899
penis0.150000
mouth mucosa0.141176
coral0.130435
subgingival plaque0.116959
monkey0.116959
induced periodontitis0.114286
LOWER IN induced periodontitis0.114286
LOWER IN age 10-15 years0.114286
LOWER IN age &lt; 1 year0.108108
oral cavity0.104348
male organism0.103448
periodontitis0.102564
LOWER IN periodontitis0.102564
vagina0.093750
female organism0.085714
LOWER IN adult organism0.085106
dentition0.076628
infant0.064171
LOWER IN age 12-23 years0.060606
LOWER IN age 1-7 years0.058824
LOWER IN penis0.058824
LOWER IN male organism0.050000
LOWER IN infant0.048193
LOWER IN vagina0.047619
child0.047393
LOWER IN female organism0.045455
mitochondrion0.045455
LOWER IN child0.029851
research facility0.013324
adult0.011161
LOWER IN control0.009975
control0.009975
LOWER IN adult0.009804
feces0.006266
Fraction of dbbact annotations with this term covered by the query
TermScore
puerto rico1.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
LOWER IN age 10-15 years0.500000
cayo santiago0.500000
indian rhesus macaque0.500000
age 10-15 years0.500000
age > 1 year0.500000
isla palominos0.500000
acropora cervicornis0.500000
macaca mulatta0.333333
age 1-7 years0.333333
LOWER IN age 1-7 years0.333333
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
penis0.333333
LOWER IN penis0.333333
periodontitis0.250000
LOWER IN periodontitis0.250000
rectal swab0.200000
coral0.200000
LOWER IN adult organism0.125000
adult organism0.125000
mouth mucosa0.111111
male organism0.111111
LOWER IN male organism0.111111
LOWER IN vagina0.090909
vagina0.090909
LOWER IN female organism0.076923
female organism0.076923
mitochondrion0.076923
subgingival plaque0.071429
monkey0.071429
oral cavity0.071429
dentition0.043478
infant0.038462
LOWER IN infant0.038462
child0.027778
LOWER IN child0.027778
research facility0.006803
adult0.005780
LOWER IN adult0.005780
LOWER IN control0.005405
control0.005405
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
puerto rico1.000000
macaca mulatta0.903226
cayo santiago0.580645
indian rhesus macaque0.580645
research facility0.322581
dentition0.322581
subgingival plaque0.322581
monkey0.322581
infant0.193548
age < 1 year0.193548
oral cavity0.193548
mouth mucosa0.193548
age 10-15 years0.193548
adult organism0.193548
feces0.193548
rectal swab0.193548
age > 1 year0.193548
adult0.161290
age 12-23 years0.161290
child0.161290
age 1-7 years0.161290
penis0.096774
male organism0.096774
vagina0.096774
female organism0.096774
isla palominos0.096774
coral0.096774
acropora cervicornis0.096774
induced periodontitis0.064516
periodontitis0.064516
LOWER IN control0.064516
control0.064516
LOWER IN induced periodontitis0.064516
LOWER IN periodontitis0.064516
LOWER IN age 10-15 years0.064516
LOWER IN adult organism0.064516
LOWER IN infant0.064516
LOWER IN age &lt; 1 year0.064516
LOWER IN adult0.032258
LOWER IN age 12-23 years0.032258
LOWER IN child0.032258
LOWER IN age 1-7 years0.032258
LOWER IN vagina0.032258
LOWER IN female organism0.032258
LOWER IN penis0.032258
LOWER IN male organism0.032258
mitochondrion0.032258
Exp. ID User ID Description Date Region Flag Sequences
549amnoncoral mitochondria (other mitochondrion, puerto rico, isla palominos, coral, acropora cervicornis)2019-08-17v4No1 / 2
549amnondominant puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 3
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
770amnondominant oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 18
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396

Problems / suggestions? Please email info AT dbbact DOT org