Summary for ontology term: rat

Number of annotations with term: 91

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGTCCTTGAGTACAGTTGAGGTGGGCGGAATTCGTGG0.463768
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGGTTTTAAGCGTGCCGTGAAATGTCGGGGCTCAACCTTGACACTGCGGCGCGAACTGGAGTCCTTGAGTGCGCGGAACGTATGCGGAATTCGTGG0.380952
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.357724
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGGCGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAACTGCTCTCAAAACTGTGCCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.350877
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGAGAGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.350877
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCATGGGCTCAACTCATGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.347826
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.344262
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTCGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.344262
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGACGGCCGAGTAAGTTATAGGTGAAAGCCCATCTTTCAAGGATGGAATTGCCTGTAATACTGCCTGGCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTAG0.339286
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.336000

Annotations:

common ontology terms
term enrichment score
TermScore
rat0.839695
rattus norvegicus0.605042
sprague dawley0.602740
rattus0.265380
swiss webster0.250000
control diet0.204082
research facility0.194968
wistar rat0.188679
male0.161468
czech republic0.152672
israel0.133333
age 38 weeks0.116505
dahl salt-sensitive0.116505
ketogenic diet0.113208
caecum0.113074
ovariectomy0.110092
colitis0.099174
LOWER IN control diet0.095238
feces0.090372
switzerland0.082759
fructose diet0.080808
fructose0.080808
LOWER IN colitis0.072072
constipation0.063830
tnbs0.061856
city of boston0.061856
low capacity running strain0.061856
rattus rattus0.061856
salt0.061856
salt rich diet0.061856
induced type 1 diabetes0.061856
neomycin0.061856
ampicillin0.060914
type i diabetes mellitus0.058252
mouse0.057143
control0.056293
new york city0.053571
state of california0.053512
LOWER IN control0.052905
mus musculus0.052632
china0.052367
antibiotic0.052174
commonwealth of massachusetts0.050847
state of new york0.047244
united states of america0.045444
mouse chow0.044118
hymenolepis diminuta0.042553
LOWER IN hymenolepis diminuta0.042553
LOWER IN fructose diet0.042105
LOWER IN fructose0.042105
LOWER IN ketogenic diet0.041667
italy0.039735
wild0.036810
female0.025586
LOWER IN constipation0.021739
35 weeks0.021505
LOWER IN 25 weeks0.021505
age 25 weeks0.021505
LOWER IN tnbs0.021505
LOWER IN city of boston0.021505
high capacity running strain0.021505
LOWER IN low capacity running strain0.021505
LOWER IN high capacity running strain0.021505
LOWER IN exercise0.021505
exercise0.021505
LOWER IN dnbs induced colitis0.021505
dnbs induced colitis0.021505
LOWER IN salt0.021505
LOWER IN salt rich diet0.021505
LOWER IN sulfasalazine0.021505
sulfasalazine0.021505
LOWER IN induced type 1 diabetes0.021505
LOWER IN age 35 weeks0.021277
sedentary0.021277
low physical activity0.021277
LOWER IN sedentary0.021277
LOWER IN low physical activity0.021277
LOWER IN type i diabetes mellitus0.021053
LOWER IN neomycin0.021053
parasitic helminthiasis infectious disease0.020833
LOWER IN parasitic helminthiasis infectious disease0.020833
LOWER IN high physical activity0.020833
high physical activity0.020833
LOWER IN ampicillin0.020833
LOWER IN small intestine0.020619
small intestine0.020619
LOWER IN new york city0.020408
late time points0.020202
LOWER IN early time points0.020202
early timepoints0.020000
LOWER IN commonwealth of massachusetts0.020000
LOWER IN late timepoints0.019802
LOWER IN state of new york0.019417
LOWER IN mouse chow0.018868
LOWER IN antibiotic0.018692
LOWER IN stomach0.018519
stomach0.018519
age0.017857
LOWER IN age0.017857
LOWER IN wild0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
constipation1.000000
LOWER IN constipation1.000000
rat0.833333
sprague dawley0.800000
hymenolepis diminuta0.666667
LOWER IN hymenolepis diminuta0.666667
wistar rat0.666667
swiss webster0.666667
rattus norvegicus0.642857
35 weeks0.500000
LOWER IN 25 weeks0.500000
age 25 weeks0.500000
LOWER IN tnbs0.500000
tnbs0.500000
city of boston0.500000
LOWER IN city of boston0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
low capacity running strain0.500000
LOWER IN high capacity running strain0.500000
LOWER IN exercise0.500000
exercise0.500000
LOWER IN dnbs induced colitis0.500000
dnbs induced colitis0.500000
rattus rattus0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
dahl salt-sensitive0.500000
salt0.500000
salt rich diet0.500000
LOWER IN sulfasalazine0.500000
sulfasalazine0.500000
LOWER IN induced type 1 diabetes0.500000
induced type 1 diabetes0.500000
LOWER IN fructose diet0.500000
LOWER IN fructose0.500000
fructose diet0.500000
fructose0.500000
neomycin0.500000
LOWER IN ketogenic diet0.400000
ketogenic diet0.400000
ampicillin0.400000
control diet0.357143
LOWER IN control diet0.357143
LOWER IN age 35 weeks0.333333
ovariectomy0.333333
sedentary0.333333
low physical activity0.333333
LOWER IN sedentary0.333333
LOWER IN low physical activity0.333333
rattus0.294118
czech republic0.250000
LOWER IN type i diabetes mellitus0.250000
type i diabetes mellitus0.250000
LOWER IN neomycin0.250000
parasitic helminthiasis infectious disease0.200000
LOWER IN parasitic helminthiasis infectious disease0.200000
LOWER IN colitis0.200000
colitis0.200000
LOWER IN high physical activity0.200000
high physical activity0.200000
LOWER IN ampicillin0.200000
LOWER IN small intestine0.166667
small intestine0.166667
new york city0.142857
LOWER IN new york city0.142857
late time points0.125000
LOWER IN early time points0.125000
antibiotic0.125000
male0.121212
israel0.117647
early timepoints0.111111
commonwealth of massachusetts0.111111
LOWER IN commonwealth of massachusetts0.111111
switzerland0.111111
research facility0.108844
LOWER IN late timepoints0.100000
caecum0.083333
state of new york0.083333
LOWER IN state of new york0.083333
mouse chow0.066667
LOWER IN mouse chow0.066667
LOWER IN antibiotic0.062500
LOWER IN stomach0.058824
stomach0.058824
italy0.050000
feces0.047771
age0.047619
LOWER IN age0.047619
wild0.041667
LOWER IN wild0.041667
state of california0.038462
LOWER IN control0.037838
control0.037838
mouse0.035088
mus musculus0.031746
china0.029070
united states of america0.024291
female0.015873
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.934066
rat0.846154
feces0.835165
rattus norvegicus0.571429
sprague dawley0.483516
united states of america0.351648
china0.263736
rattus0.241758
male0.241758
caecum0.175824
mus musculus0.153846
mouse0.153846
swiss webster0.153846
israel0.153846
control diet0.142857
control0.109890
czech republic0.109890
wistar rat0.109890
LOWER IN control0.087912
state of california0.087912
colitis0.065934
ketogenic diet0.065934
female0.065934
ovariectomy0.065934
age 38 weeks0.065934
dahl salt-sensitive0.065934
switzerland0.065934
LOWER IN control diet0.054945
LOWER IN colitis0.043956
fructose diet0.043956
fructose0.043956
tnbs0.032967
commonwealth of massachusetts0.032967
city of boston0.032967
state of new york0.032967
new york city0.032967
wild0.032967
constipation0.032967
mouse chow0.032967
low capacity running strain0.032967
italy0.032967
rattus rattus0.032967
salt0.032967
salt rich diet0.032967
type i diabetes mellitus0.032967
induced type 1 diabetes0.032967
antibiotic0.032967
ampicillin0.032967
neomycin0.032967
hymenolepis diminuta0.021978
LOWER IN hymenolepis diminuta0.021978
LOWER IN ketogenic diet0.021978
LOWER IN fructose diet0.021978
LOWER IN fructose0.021978
parasitic helminthiasis infectious disease0.010989
LOWER IN parasitic helminthiasis infectious disease0.010989
age0.010989
late time points0.010989
35 weeks0.010989
LOWER IN early time points0.010989
LOWER IN 25 weeks0.010989
early timepoints0.010989
age 25 weeks0.010989
LOWER IN age0.010989
LOWER IN late timepoints0.010989
LOWER IN age 35 weeks0.010989
LOWER IN tnbs0.010989
LOWER IN research facility0.010989
LOWER IN commonwealth of massachusetts0.010989
LOWER IN city of boston0.010989
LOWER IN state of new york0.010989
LOWER IN new york city0.010989
LOWER IN wild0.010989
LOWER IN constipation0.010989
high capacity running strain0.010989
LOWER IN low capacity running strain0.010989
LOWER IN high capacity running strain0.010989
sedentary0.010989
low physical activity0.010989
LOWER IN exercise0.010989
LOWER IN high physical activity0.010989
exercise0.010989
high physical activity0.010989
LOWER IN sedentary0.010989
LOWER IN low physical activity0.010989
LOWER IN dnbs induced colitis0.010989
dnbs induced colitis0.010989
LOWER IN salt0.010989
LOWER IN salt rich diet0.010989
LOWER IN sulfasalazine0.010989
sulfasalazine0.010989
LOWER IN type i diabetes mellitus0.010989
LOWER IN induced type 1 diabetes0.010989
LOWER IN antibiotic0.010989
LOWER IN ampicillin0.010989
LOWER IN neomycin0.010989
LOWER IN mouse chow0.010989
LOWER IN stomach0.010989
LOWER IN small intestine0.010989
stomach0.010989
Exp. ID User ID Description Date Region Flag Sequences
666amnondominant feces, italy, rat, rattus rattus2020-09-25v3No1 / 1
434amnon high in control diet compared to fructose diet fructose in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 1
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 3
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 4
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 5
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
187amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 14
666amnondominant feces, italy, rat, rattus rattus2020-09-25v3No1 / 14
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 15
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 15
358amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
434amnon high in fructose diet fructose compared to control diet in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
419amnondominant feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 18
419amnonhigh freq. in rats with induced constipation (dominant feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 20
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 20
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 20
442amnondominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 21
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 21
221amnondominant feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to age late timepoints age 35 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 23
349amnondominant feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 24
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 27
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 27
187amnonpositively correlated with age 25-35 weeks ( high in age late time points 35 weeks compared to early time points 25 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 33
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 36
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 38
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 44
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 47
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 52
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 70
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 82
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 120
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 130
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 179
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 238
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v3No1 / 406
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754

Problems / suggestions? Please email info AT dbbact DOT org