Summary for ontology term: rat

Number of annotations with term: 93

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGTCCTTGAGTACAGTTGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGGTTTTAAGCGTGCCGTGAAATGTCGGGGCTCAACCTTGACACTGCGGCGCGAACTGGAGTCCTTGAGTGCGCGGAACGTATGCGGAATTCGTGG0.414815
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGGCGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAACTGCTCTCAAAACTGTGCCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.392157
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGAGAGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.392157
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.389381
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCATGGGCTCAACTCATGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.384615
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.381818
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTCGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.381818
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGACGGCCGAGTAAGTTATAGGTGAAAGCCCATCTTTCAAGGATGGAATTGCCTGTAATACTGCCTGGCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTAG0.380000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.371681

Annotations:

common ontology terms
term enrichment score
TermScore
rat0.892971
rattus norvegicus0.708661
sprague dawley0.616530
rattus0.368509
swiss webster0.245614
control diet0.189504
wistar rat0.185185
research facility0.172438
czech republic0.150376
israel0.132075
male0.131343
age 38 weeks0.114286
dahl salt-sensitive0.114286
colitis0.112150
ketogenic diet0.111111
ovariectomy0.108108
LOWER IN control diet0.090909
caecum0.090310
switzerland0.081633
fructose diet0.079208
fructose0.079208
LOWER IN colitis0.077170
feces0.074561
tnbs0.060606
constipation0.060606
low capacity running strain0.060606
rattus rattus0.060606
salt0.060606
salt rich diet0.060606
induced type 1 diabetes0.060606
neomycin0.060606
ampicillin0.059701
city of boston0.058824
type i diabetes mellitus0.057143
new york city0.052632
control0.052612
mouse0.051756
LOWER IN control0.050473
commonwealth of massachusetts0.050000
antibiotic0.049383
mus musculus0.047458
china0.047087
state of california0.046921
state of new york0.046512
mouse chow0.044444
hymenolepis diminuta0.041667
LOWER IN hymenolepis diminuta0.041667
LOWER IN fructose diet0.041237
LOWER IN fructose0.041237
LOWER IN ketogenic diet0.040816
united states of america0.040075
italy0.035088
wild0.031250
oral cavity0.030534
japan0.030075
female0.023392
35 weeks0.021053
LOWER IN 25 weeks0.021053
age 25 weeks0.021053
LOWER IN age 35 weeks0.021053
LOWER IN tnbs0.021053
LOWER IN commonwealth of massachusetts0.021053
LOWER IN city of boston0.021053
LOWER IN state of new york0.021053
LOWER IN new york city0.021053
LOWER IN constipation0.021053
high capacity running strain0.021053
LOWER IN low capacity running strain0.021053
LOWER IN high capacity running strain0.021053
LOWER IN exercise0.021053
exercise0.021053
LOWER IN dnbs induced colitis0.021053
dnbs induced colitis0.021053
LOWER IN salt0.021053
LOWER IN salt rich diet0.021053
LOWER IN sulfasalazine0.021053
sulfasalazine0.021053
LOWER IN induced type 1 diabetes0.021053
sedentary0.020833
low physical activity0.020833
LOWER IN high physical activity0.020833
LOWER IN sedentary0.020833
LOWER IN low physical activity0.020833
LOWER IN neomycin0.020833
parasitic helminthiasis infectious disease0.020619
LOWER IN parasitic helminthiasis infectious disease0.020619
LOWER IN type i diabetes mellitus0.020619
LOWER IN ampicillin0.020619
high physical activity0.020408
LOWER IN small intestine0.020202
small intestine0.020202
LOWER IN age0.020000
LOWER IN research facility0.020000
late time points0.019802
LOWER IN early time points0.019802
early timepoints0.019608
LOWER IN late timepoints0.019608
LOWER IN stomach0.019417
LOWER IN wild0.018692
LOWER IN mouse chow0.018349
Fraction of dbbact annotations with this term covered by the query
TermScore
rat0.941176
rattus norvegicus0.909091
rattus0.833333
sprague dawley0.818182
hymenolepis diminuta0.666667
LOWER IN hymenolepis diminuta0.666667
wistar rat0.666667
swiss webster0.666667
35 weeks0.500000
LOWER IN 25 weeks0.500000
age 25 weeks0.500000
LOWER IN age 35 weeks0.500000
LOWER IN tnbs0.500000
tnbs0.500000
LOWER IN commonwealth of massachusetts0.500000
LOWER IN city of boston0.500000
LOWER IN state of new york0.500000
LOWER IN new york city0.500000
constipation0.500000
LOWER IN constipation0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
low capacity running strain0.500000
LOWER IN high capacity running strain0.500000
LOWER IN exercise0.500000
exercise0.500000
LOWER IN dnbs induced colitis0.500000
dnbs induced colitis0.500000
rattus rattus0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
dahl salt-sensitive0.500000
salt0.500000
salt rich diet0.500000
LOWER IN sulfasalazine0.500000
sulfasalazine0.500000
LOWER IN induced type 1 diabetes0.500000
induced type 1 diabetes0.500000
LOWER IN fructose diet0.500000
LOWER IN fructose0.500000
fructose diet0.500000
fructose0.500000
neomycin0.500000
colitis0.428571
LOWER IN ketogenic diet0.400000
ketogenic diet0.400000
ampicillin0.400000
LOWER IN colitis0.375000
city of boston0.333333
ovariectomy0.333333
sedentary0.333333
low physical activity0.333333
LOWER IN high physical activity0.333333
LOWER IN sedentary0.333333
LOWER IN low physical activity0.333333
LOWER IN neomycin0.333333
control diet0.294118
LOWER IN control diet0.294118
parasitic helminthiasis infectious disease0.250000
LOWER IN parasitic helminthiasis infectious disease0.250000
czech republic0.250000
LOWER IN type i diabetes mellitus0.250000
type i diabetes mellitus0.250000
LOWER IN ampicillin0.250000
high physical activity0.200000
LOWER IN small intestine0.166667
small intestine0.166667
LOWER IN age0.142857
new york city0.142857
LOWER IN research facility0.142857
late time points0.125000
LOWER IN early time points0.125000
israel0.117647
early timepoints0.111111
LOWER IN late timepoints0.111111
commonwealth of massachusetts0.111111
switzerland0.111111
antibiotic0.105263
LOWER IN stomach0.100000
research facility0.094972
male0.090909
state of new york0.083333
LOWER IN wild0.071429
mouse chow0.071429
LOWER IN mouse chow0.062500
caecum0.061224
LOWER IN antibiotic0.058824
stomach0.058824
oral cavity0.052632
japan0.050000
age0.047619
feces0.039062
italy0.038462
LOWER IN feces0.037037
LOWER IN control0.035714
control0.034826
state of california0.032258
mouse0.031250
wild0.030303
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.935484
rat0.849462
feces0.817204
rattus norvegicus0.580645
sprague dawley0.494624
united states of america0.344086
china0.258065
rattus0.236559
male0.236559
caecum0.172043
mus musculus0.150538
mouse0.150538
swiss webster0.150538
israel0.150538
control diet0.139785
control0.107527
czech republic0.107527
wistar rat0.107527
LOWER IN control0.086022
state of california0.086022
colitis0.064516
ketogenic diet0.064516
female0.064516
ovariectomy0.064516
age 38 weeks0.064516
dahl salt-sensitive0.064516
switzerland0.064516
LOWER IN control diet0.053763
LOWER IN colitis0.043011
fructose diet0.043011
fructose0.043011
tnbs0.032258
commonwealth of massachusetts0.032258
city of boston0.032258
state of new york0.032258
new york city0.032258
wild0.032258
constipation0.032258
mouse chow0.032258
low capacity running strain0.032258
italy0.032258
rattus rattus0.032258
salt0.032258
salt rich diet0.032258
type i diabetes mellitus0.032258
induced type 1 diabetes0.032258
antibiotic0.032258
ampicillin0.032258
neomycin0.032258
hymenolepis diminuta0.021505
LOWER IN hymenolepis diminuta0.021505
LOWER IN ketogenic diet0.021505
oral cavity0.021505
japan0.021505
LOWER IN fructose diet0.021505
LOWER IN fructose0.021505
parasitic helminthiasis infectious disease0.010753
LOWER IN parasitic helminthiasis infectious disease0.010753
age0.010753
late time points0.010753
35 weeks0.010753
LOWER IN early time points0.010753
LOWER IN 25 weeks0.010753
early timepoints0.010753
age 25 weeks0.010753
LOWER IN age0.010753
LOWER IN late timepoints0.010753
LOWER IN age 35 weeks0.010753
LOWER IN tnbs0.010753
LOWER IN research facility0.010753
LOWER IN commonwealth of massachusetts0.010753
LOWER IN city of boston0.010753
LOWER IN state of new york0.010753
LOWER IN new york city0.010753
LOWER IN wild0.010753
LOWER IN constipation0.010753
high capacity running strain0.010753
LOWER IN low capacity running strain0.010753
LOWER IN high capacity running strain0.010753
sedentary0.010753
low physical activity0.010753
LOWER IN exercise0.010753
LOWER IN high physical activity0.010753
exercise0.010753
high physical activity0.010753
LOWER IN sedentary0.010753
LOWER IN low physical activity0.010753
LOWER IN dnbs induced colitis0.010753
dnbs induced colitis0.010753
LOWER IN salt0.010753
LOWER IN salt rich diet0.010753
LOWER IN sulfasalazine0.010753
sulfasalazine0.010753
LOWER IN type i diabetes mellitus0.010753
LOWER IN induced type 1 diabetes0.010753
LOWER IN antibiotic0.010753
LOWER IN ampicillin0.010753
LOWER IN neomycin0.010753
LOWER IN mouse chow0.010753
LOWER IN stomach0.010753
Number of experiments associating the term to the sequence
TermScore
research facility17.000000
rat16.000000
feces15.000000
rattus norvegicus10.000000
sprague dawley9.000000
LOWER IN control7.000000
control7.000000
united states of america6.000000
rattus5.000000
china5.000000
control diet5.000000
LOWER IN control diet5.000000
male4.000000
caecum3.000000
LOWER IN colitis3.000000
colitis3.000000
hymenolepis diminuta2.000000
LOWER IN hymenolepis diminuta2.000000
czech republic2.000000
wistar rat2.000000
LOWER IN ketogenic diet2.000000
mus musculus2.000000
mouse2.000000
swiss webster2.000000
ketogenic diet2.000000
israel2.000000
LOWER IN fructose diet2.000000
LOWER IN fructose2.000000
fructose diet2.000000
fructose2.000000
antibiotic2.000000
ampicillin2.000000
neomycin2.000000
parasitic helminthiasis infectious disease1.000000
LOWER IN parasitic helminthiasis infectious disease1.000000
age1.000000
late time points1.000000
35 weeks1.000000
LOWER IN early time points1.000000
LOWER IN 25 weeks1.000000
early timepoints1.000000
age 25 weeks1.000000
LOWER IN age1.000000
LOWER IN late timepoints1.000000
LOWER IN age 35 weeks1.000000
LOWER IN tnbs1.000000
tnbs1.000000
oral cavity1.000000
japan1.000000
commonwealth of massachusetts1.000000
city of boston1.000000
state of new york1.000000
new york city1.000000
wild1.000000
LOWER IN research facility1.000000
LOWER IN commonwealth of massachusetts1.000000
LOWER IN city of boston1.000000
LOWER IN state of new york1.000000
LOWER IN new york city1.000000
LOWER IN wild1.000000
constipation1.000000
LOWER IN constipation1.000000
state of california1.000000
mouse chow1.000000
high capacity running strain1.000000
LOWER IN low capacity running strain1.000000
female1.000000
ovariectomy1.000000
age 38 weeks1.000000
low capacity running strain1.000000
LOWER IN high capacity running strain1.000000
sedentary1.000000
low physical activity1.000000
LOWER IN exercise1.000000
LOWER IN high physical activity1.000000
exercise1.000000
high physical activity1.000000
LOWER IN sedentary1.000000
LOWER IN low physical activity1.000000
LOWER IN dnbs induced colitis1.000000
dnbs induced colitis1.000000
italy1.000000
rattus rattus1.000000
LOWER IN salt1.000000
LOWER IN salt rich diet1.000000
dahl salt-sensitive1.000000
salt1.000000
salt rich diet1.000000
LOWER IN sulfasalazine1.000000
sulfasalazine1.000000
LOWER IN type i diabetes mellitus1.000000
LOWER IN induced type 1 diabetes1.000000
type i diabetes mellitus1.000000
induced type 1 diabetes1.000000
switzerland1.000000
LOWER IN antibiotic1.000000
LOWER IN ampicillin1.000000
LOWER IN neomycin1.000000
LOWER IN mouse chow1.000000
LOWER IN stomach1.000000
LOWER IN small intestine1.000000
stomach1.000000
small intestine1.000000
LOWER IN feces1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
666amnondominant feces, italy, rat, rattus rattus2020-09-25v31 / 1approvedNo
434amnon high in control diet compared to fructose diet fructose in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v41 / 1approvedNo
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v41 / 3approvedNo
923amnondominant research facility, oral cavity, rattus norvegicus, sprague dawley, rat, japan2022-07-27v31 / 4approvedNo
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v41 / 4approvedNo
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v41 / 5approvedNo
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v41 / 5approvedNo
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 11approvedNo
187amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v41 / 13approvedNo
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v41 / 13approvedNo
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v41 / 13approvedNo
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v41 / 14approvedNo
666amnondominant feces, italy, rat, rattus rattus2020-09-25v31 / 14approvedNo
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v41 / 15approvedNo
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v41 / 15approvedNo
358amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v41 / 15approvedNo
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v41 / 15approvedNo
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v41 / 16approvedNo
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v31 / 16approvedNo
434amnon high in fructose diet fructose compared to control diet in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v41 / 16approvedNo
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v41 / 16approvedNo
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v41 / 17approvedNo
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v41 / 17approvedNo
419amnondominant feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v41 / 18approvedNo
419amnonhigh freq. in rats with induced constipation (dominant feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v41 / 20approvedNo
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v41 / 20approvedNo
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v41 / 20approvedNo
442amnondominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v41 / 21approvedNo
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v41 / 21approvedNo
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v41 / 21approvedNo
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v41 / 21approvedNo
221amnondominant feces, research facility, sprague dawley, rattus, rat, china2017-10-25v41 / 21approvedNo
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v41 / 21approvedNo
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to age late timepoints age 35 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v41 / 23approvedNo
349amnondominant feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v41 / 24approvedNo
923amnoncommon research facility, oral cavity, rattus norvegicus, sprague dawley, rat, japan2022-07-27v31 / 24approvedNo
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v31 / 26approvedNo
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v41 / 27approvedNo
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v31 / 27approvedNo
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v41 / 27approvedNo
187amnonpositively correlated with age 25-35 weeks ( high in age late time points 35 weeks compared to early time points 25 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v41 / 33approvedNo
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v41 / 36approvedNo
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v31 / 38approvedNo
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v41 / 44approvedNo
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 44approvedNo
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v41 / 45approvedNo
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v41 / 47approvedNo
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v41 / 49approvedNo
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 49approvedNo
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v41 / 49approvedNo
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v41 / 52approvedNo
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v41 / 61approvedNo
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v41 / 63approvedNo
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v41 / 68approvedNo
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v41 / 70approvedNo
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v41 / 70approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v41 / 80approvedNo
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 82approvedNo
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v41 / 85approvedNo
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v41 / 94approvedNo
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v41 / 96approvedNo
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v41 / 107approvedNo
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 120approvedNo
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v41 / 130approvedNo
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v41 / 141approvedNo
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v41 / 150approvedNo
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v41 / 151approvedNo
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 154approvedNo
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v41 / 177approvedNo
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v41 / 179approvedNo
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v41 / 184approvedNo
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v31 / 202approvedNo
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v41 / 203approvedNo
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v41 / 217approvedNo
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v31 / 221approvedNo
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v41 / 235approvedNo
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v41 / 238approvedNo
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v41 / 238approvedNo
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v41 / 241approvedNo
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v41 / 249approvedNo
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v41 / 254approvedNo
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v41 / 287approvedNo
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v41 / 300approvedNo
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v41 / 309approvedNo
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v41 / 327approvedNo
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v41 / 329approvedNo
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v41 / 351approvedNo
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v41 / 360approvedNo
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v41 / 378approvedNo
666amnoncommon feces, italy, rat, rattus rattus2020-09-25v31 / 406approvedNo
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v41 / 407approvedNo
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v41 / 470approvedNo
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v41 / 754approvedNo

Problems / suggestions? Please email info AT dbbact DOT org