Summary for ontology term: rattus norvegicus

Number of annotations with term: 68

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGTCCTTGAGTACAGTTGAGGTGGGCGGAATTCGTGG0.413793
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCATGGGCTCAACTCATGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.387097
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.376238
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGGTTTTAAGCGTGCCGTGAAATGTCGGGGCTCAACCTTGACACTGCGGCGCGAACTGGAGTCCTTGAGTGCGCGGAACGTATGCGGAATTCGTGG0.370968
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.363636
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.352941
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGAGAGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.351648
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGACGGTAAGTCAGCGGTAAAAATGCGGAGCTCAACTCCGTCGAGCCGTTGAAACTGCCGTTCTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGT0.351648
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCTGCTGGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.348837
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTCGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.343434

Annotations:

common ontology terms
term enrichment score
TermScore
rat0.828185
sprague dawley0.827586
rattus norvegicus0.752089
rattus0.176471
research facility0.158509
age 38 weeks0.150000
dahl salt-sensitive0.150000
israel0.149733
male0.141935
ovariectomy0.139535
control diet0.135922
caecum0.109589
fructose diet0.105263
fructose0.105263
switzerland0.098361
oral cavity0.081633
tnbs0.081081
constipation0.081081
low capacity running strain0.081081
salt0.081081
salt rich diet0.081081
induced type 1 diabetes0.081081
neomycin0.081081
colitis0.079681
ampicillin0.079470
city of boston0.077922
type i diabetes mellitus0.075000
LOWER IN control diet0.072289
new york city0.067416
commonwealth of massachusetts0.063158
antibiotic0.063158
china0.059793
LOWER IN colitis0.058537
state of new york0.056075
feces0.055930
LOWER IN fructose diet0.055556
LOWER IN fructose0.055556
control0.049793
female0.048193
LOWER IN control0.046512
sichuan province0.045455
female organism0.041667
wild0.041096
japan0.039216
united states of america0.029185
LOWER IN tnbs0.028571
LOWER IN constipation0.028571
high capacity running strain0.028571
LOWER IN low capacity running strain0.028571
LOWER IN high capacity running strain0.028571
LOWER IN exercise0.028571
exercise0.028571
LOWER IN salt0.028571
LOWER IN salt rich diet0.028571
LOWER IN sulfasalazine0.028571
sulfasalazine0.028571
LOWER IN induced type 1 diabetes0.028571
hymenolepis diminuta0.028169
LOWER IN hymenolepis diminuta0.028169
LOWER IN city of boston0.028169
sedentary0.028169
low physical activity0.028169
LOWER IN sedentary0.028169
LOWER IN low physical activity0.028169
LOWER IN type i diabetes mellitus0.027778
LOWER IN neomycin0.027778
parasitic helminthiasis infectious disease0.027397
LOWER IN parasitic helminthiasis infectious disease0.027397
LOWER IN high physical activity0.027397
high physical activity0.027397
LOWER IN ampicillin0.027397
LOWER IN new york city0.026667
LOWER IN commonwealth of massachusetts0.025974
LOWER IN state of new york0.024691
LOWER IN antibiotic0.023256
LOWER IN wild0.021277
LOWER IN research facility0.008696
Fraction of dbbact annotations with this term covered by the query
TermScore
sprague dawley1.000000
rat0.722222
rattus norvegicus0.714286
LOWER IN tnbs0.500000
tnbs0.500000
constipation0.500000
LOWER IN constipation0.500000
age 38 weeks0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
low capacity running strain0.500000
LOWER IN high capacity running strain0.500000
LOWER IN exercise0.500000
exercise0.500000
dahl salt-sensitive0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
salt0.500000
salt rich diet0.500000
LOWER IN sulfasalazine0.500000
sulfasalazine0.500000
LOWER IN induced type 1 diabetes0.500000
induced type 1 diabetes0.500000
LOWER IN fructose diet0.500000
LOWER IN fructose0.500000
fructose diet0.500000
fructose0.500000
neomycin0.500000
ampicillin0.400000
hymenolepis diminuta0.333333
LOWER IN hymenolepis diminuta0.333333
city of boston0.333333
LOWER IN city of boston0.333333
ovariectomy0.333333
sedentary0.333333
low physical activity0.333333
LOWER IN sedentary0.333333
LOWER IN low physical activity0.333333
LOWER IN type i diabetes mellitus0.250000
type i diabetes mellitus0.250000
LOWER IN neomycin0.250000
parasitic helminthiasis infectious disease0.200000
LOWER IN parasitic helminthiasis infectious disease0.200000
LOWER IN high physical activity0.200000
high physical activity0.200000
control diet0.200000
LOWER IN control diet0.200000
LOWER IN ampicillin0.200000
rattus0.176471
new york city0.142857
LOWER IN new york city0.142857
oral cavity0.133333
israel0.117647
commonwealth of massachusetts0.111111
LOWER IN commonwealth of massachusetts0.111111
switzerland0.111111
antibiotic0.111111
sichuan province0.100000
male0.090909
LOWER IN colitis0.086957
colitis0.086957
research facility0.086420
state of new york0.076923
LOWER IN state of new york0.076923
caecum0.071429
female organism0.071429
japan0.058824
LOWER IN antibiotic0.055556
wild0.038462
LOWER IN wild0.038462
china0.032432
LOWER IN control0.031579
control0.031579
female0.030303
feces0.028986
united states of america0.015444
LOWER IN research facility0.006173
Fraction of annotations for the query sequences containing the term
TermScore
rat0.970588
research facility0.955882
feces0.794118
rattus norvegicus0.794118
sprague dawley0.705882
china0.382353
male0.323529
united states of america0.264706
caecum0.235294
israel0.205882
rattus0.176471
control0.117647
female0.117647
control diet0.102941
LOWER IN control0.088235
ovariectomy0.088235
age 38 weeks0.088235
dahl salt-sensitive0.088235
switzerland0.088235
colitis0.073529
oral cavity0.058824
fructose diet0.058824
fructose0.058824
LOWER IN colitis0.044118
tnbs0.044118
city of boston0.044118
commonwealth of massachusetts0.044118
state of new york0.044118
new york city0.044118
wild0.044118
constipation0.044118
low capacity running strain0.044118
salt0.044118
salt rich diet0.044118
LOWER IN control diet0.044118
induced type 1 diabetes0.044118
type i diabetes mellitus0.044118
antibiotic0.044118
neomycin0.044118
ampicillin0.044118
japan0.029412
sichuan province0.029412
female organism0.029412
LOWER IN fructose diet0.029412
LOWER IN fructose0.029412
parasitic helminthiasis infectious disease0.014706
hymenolepis diminuta0.014706
LOWER IN parasitic helminthiasis infectious disease0.014706
LOWER IN hymenolepis diminuta0.014706
LOWER IN tnbs0.014706
LOWER IN research facility0.014706
LOWER IN city of boston0.014706
LOWER IN commonwealth of massachusetts0.014706
LOWER IN wild0.014706
LOWER IN state of new york0.014706
LOWER IN new york city0.014706
LOWER IN constipation0.014706
high capacity running strain0.014706
LOWER IN low capacity running strain0.014706
LOWER IN high capacity running strain0.014706
sedentary0.014706
low physical activity0.014706
LOWER IN exercise0.014706
LOWER IN high physical activity0.014706
exercise0.014706
high physical activity0.014706
LOWER IN sedentary0.014706
LOWER IN low physical activity0.014706
LOWER IN salt0.014706
LOWER IN salt rich diet0.014706
LOWER IN sulfasalazine0.014706
sulfasalazine0.014706
LOWER IN type i diabetes mellitus0.014706
LOWER IN induced type 1 diabetes0.014706
LOWER IN antibiotic0.014706
LOWER IN neomycin0.014706
LOWER IN ampicillin0.014706
Number of experiments associating the term to the sequence
TermScore
research facility14.000000
rat13.000000
feces10.000000
rattus norvegicus10.000000
sprague dawley10.000000
china6.000000
LOWER IN control6.000000
control6.000000
united states of america4.000000
male4.000000
rattus3.000000
caecum3.000000
control diet3.000000
LOWER IN control diet3.000000
LOWER IN colitis2.000000
colitis2.000000
oral cavity2.000000
female2.000000
israel2.000000
LOWER IN fructose diet2.000000
LOWER IN fructose2.000000
fructose diet2.000000
fructose2.000000
antibiotic2.000000
neomycin2.000000
ampicillin2.000000
parasitic helminthiasis infectious disease1.000000
hymenolepis diminuta1.000000
LOWER IN parasitic helminthiasis infectious disease1.000000
LOWER IN hymenolepis diminuta1.000000
LOWER IN tnbs1.000000
tnbs1.000000
japan1.000000
city of boston1.000000
commonwealth of massachusetts1.000000
state of new york1.000000
new york city1.000000
wild1.000000
LOWER IN research facility1.000000
LOWER IN city of boston1.000000
LOWER IN commonwealth of massachusetts1.000000
LOWER IN wild1.000000
LOWER IN state of new york1.000000
LOWER IN new york city1.000000
constipation1.000000
LOWER IN constipation1.000000
sichuan province1.000000
female organism1.000000
ovariectomy1.000000
age 38 weeks1.000000
high capacity running strain1.000000
LOWER IN low capacity running strain1.000000
low capacity running strain1.000000
LOWER IN high capacity running strain1.000000
sedentary1.000000
low physical activity1.000000
LOWER IN exercise1.000000
LOWER IN high physical activity1.000000
exercise1.000000
high physical activity1.000000
LOWER IN sedentary1.000000
LOWER IN low physical activity1.000000
dahl salt-sensitive1.000000
LOWER IN salt1.000000
LOWER IN salt rich diet1.000000
salt1.000000
salt rich diet1.000000
LOWER IN sulfasalazine1.000000
sulfasalazine1.000000
LOWER IN type i diabetes mellitus1.000000
LOWER IN induced type 1 diabetes1.000000
induced type 1 diabetes1.000000
type i diabetes mellitus1.000000
switzerland1.000000
LOWER IN antibiotic1.000000
LOWER IN neomycin1.000000
LOWER IN ampicillin1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
434amnon high in control diet compared to fructose diet fructose in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v41 / 1approvedNo
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v41 / 3approvedNo
923amnondominant japan, rat, sprague dawley, rattus norvegicus, oral cavity, research facility2022-07-27v31 / 4approvedNo
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v41 / 5approvedNo
300amnon high in exercise high physical activity compared to sedentary low physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v41 / 5approvedNo
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 11approvedNo
186amnondominant rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v41 / 14approvedNo
300amnondominant rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v41 / 15approvedNo
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v41 / 15approvedNo
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v31 / 16approvedNo
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v41 / 16approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v41 / 16approvedNo
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 17approvedNo
300amnon high in sedentary low physical activity compared to exercise high physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v41 / 17approvedNo
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v41 / 18approvedNo
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v41 / 20approvedNo
697amnondominant sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v31 / 20approvedNo
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v41 / 20approvedNo
434amnondominant rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v41 / 20approvedNo
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v41 / 21approvedNo
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v41 / 21approvedNo
759amnondominant city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 21approvedNo
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v41 / 21approvedNo
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v41 / 21approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v41 / 21approvedNo
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v41 / 24approvedNo
923amnoncommon oral cavity, japan, research facility, sprague dawley, rattus norvegicus, rat2022-07-27v31 / 24approvedNo
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v31 / 26approvedNo
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 27approvedNo
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v31 / 27approvedNo
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v41 / 27approvedNo
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v41 / 36approvedNo
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v31 / 38approvedNo
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v41 / 44approvedNo
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 44approvedNo
300amnon high in high capacity running strain compared to low capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v41 / 45approvedNo
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v41 / 47approvedNo
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v41 / 49approvedNo
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 49approvedNo
300amnon high in low capacity running strain compared to high capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v41 / 52approvedNo
586amnon high in control diet compared to fructose diet fructose in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v41 / 61approvedNo
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v41 / 63approvedNo
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v41 / 68approvedNo
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v41 / 70approvedNo
697amnoncommon sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v31 / 73approvedNo
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v41 / 80approvedNo
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 94approvedNo
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v41 / 96approvedNo
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v41 / 130approvedNo
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v41 / 150approvedNo
759amnoncommon city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v41 / 179approvedNo
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v41 / 184approvedNo
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v31 / 202approvedNo
759amnon high in commonwealth of massachusetts city of boston research facility compared to wild state of new york new york city in feces united states of america rattus norvegicus rat 2021-04-06v41 / 217approvedNo
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v31 / 221approvedNo
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v41 / 235approvedNo
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v41 / 238approvedNo
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v41 / 238approvedNo
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v41 / 241approvedNo
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v41 / 249approvedNo
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v41 / 254approvedNo
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v41 / 287approvedNo
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v41 / 300approvedNo
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v41 / 327approvedNo
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v41 / 360approvedNo
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v41 / 378approvedNo
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v41 / 407approvedNo
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v41 / 470approvedNo

Problems / suggestions? Please email info AT dbbact DOT org