Summary for ontology term: rattus norvegicus

Number of annotations with term: 66

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCGTCCTTGAGTACAGTTGAGGTGGGCGGAATTCGTGG0.424779
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCATGGGCTCAACTCATGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.387755
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGGTTTTAAGCGTGCCGTGAAATGTCGGGGCTCAACCTTGACACTGCGGCGCGAACTGGAGTCCTTGAGTGCGCGGAACGTATGCGGAATTCGTGG0.377049
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCATGGGCTCAACCCGTGGACTGCATTGGAAACTGGTATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.371134
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGGAAGCAAGTCAGATGTGAAAACCACGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.360000
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGAGAGGCTTGAGTGCAGGAGAGGTTAGTGGAATTCCCAG0.359551
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGACGGTAAGTCAGCGGTAAAAATGCGGAGCTCAACTCCGTCGAGCCGTTGAAACTGCCGTTCTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGT0.359551
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCTGCTGGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGGAGTGAAAGGCTGGGGCCCAACCCCGGGACTGCTCTGGAAACTGTTAAACTGGAGTGCAGGAGAGGCAGGCGGAATTCCTAG0.351648

Annotations:

common ontology terms
term enrichment score
TermScore
rat0.790123
sprague dawley0.785579
rattus norvegicus0.708018
rattus0.179104
male0.177778
research facility0.161874
age 38 weeks0.153846
dahl salt-sensitive0.153846
israel0.151351
ovariectomy0.142857
control diet0.141892
caecum0.124031
fructose diet0.108108
fructose0.108108
switzerland0.100000
colitis0.096618
constipation0.086957
tnbs0.083333
city of boston0.083333
low capacity running strain0.083333
salt0.083333
salt rich diet0.083333
induced type 1 diabetes0.083333
neomycin0.083333
ampicillin0.081633
type i diabetes mellitus0.076923
LOWER IN control diet0.075000
new york city0.068966
LOWER IN colitis0.067797
antibiotic0.066667
commonwealth of massachusetts0.064516
china0.064092
feces0.061308
state of new york0.058824
LOWER IN fructose diet0.057143
LOWER IN fructose0.057143
control0.051173
female0.050314
LOWER IN control0.047809
sichuan province0.046512
wild0.043478
female organism0.043478
oral cavity0.042553
united states of america0.030573
LOWER IN constipation0.029851
LOWER IN tnbs0.029412
LOWER IN city of boston0.029412
high capacity running strain0.029412
LOWER IN low capacity running strain0.029412
LOWER IN high capacity running strain0.029412
LOWER IN exercise0.029412
exercise0.029412
LOWER IN salt0.029412
LOWER IN salt rich diet0.029412
LOWER IN sulfasalazine0.029412
sulfasalazine0.029412
LOWER IN induced type 1 diabetes0.029412
hymenolepis diminuta0.028986
LOWER IN hymenolepis diminuta0.028986
sedentary0.028986
low physical activity0.028986
LOWER IN sedentary0.028986
LOWER IN low physical activity0.028986
LOWER IN type i diabetes mellitus0.028571
LOWER IN neomycin0.028571
parasitic helminthiasis infectious disease0.028169
LOWER IN parasitic helminthiasis infectious disease0.028169
LOWER IN high physical activity0.028169
high physical activity0.028169
LOWER IN ampicillin0.028169
LOWER IN new york city0.027397
LOWER IN commonwealth of massachusetts0.026667
LOWER IN state of new york0.025641
LOWER IN antibiotic0.024390
LOWER IN wild0.022222
LOWER IN research facility0.009390
Fraction of dbbact annotations with this term covered by the query
TermScore
constipation1.000000
LOWER IN constipation1.000000
sprague dawley0.900000
rat0.666667
rattus norvegicus0.642857
LOWER IN tnbs0.500000
tnbs0.500000
city of boston0.500000
LOWER IN city of boston0.500000
high capacity running strain0.500000
LOWER IN low capacity running strain0.500000
age 38 weeks0.500000
low capacity running strain0.500000
LOWER IN high capacity running strain0.500000
LOWER IN exercise0.500000
exercise0.500000
LOWER IN salt0.500000
LOWER IN salt rich diet0.500000
dahl salt-sensitive0.500000
salt0.500000
salt rich diet0.500000
LOWER IN sulfasalazine0.500000
sulfasalazine0.500000
LOWER IN induced type 1 diabetes0.500000
induced type 1 diabetes0.500000
LOWER IN fructose diet0.500000
LOWER IN fructose0.500000
fructose diet0.500000
fructose0.500000
neomycin0.500000
ampicillin0.400000
hymenolepis diminuta0.333333
LOWER IN hymenolepis diminuta0.333333
ovariectomy0.333333
sedentary0.333333
low physical activity0.333333
LOWER IN sedentary0.333333
LOWER IN low physical activity0.333333
LOWER IN type i diabetes mellitus0.250000
type i diabetes mellitus0.250000
LOWER IN neomycin0.250000
control diet0.214286
LOWER IN control diet0.214286
parasitic helminthiasis infectious disease0.200000
LOWER IN parasitic helminthiasis infectious disease0.200000
LOWER IN high physical activity0.200000
high physical activity0.200000
LOWER IN ampicillin0.200000
rattus0.176471
new york city0.142857
LOWER IN new york city0.142857
LOWER IN colitis0.133333
colitis0.133333
antibiotic0.125000
male0.121212
israel0.117647
commonwealth of massachusetts0.111111
LOWER IN commonwealth of massachusetts0.111111
switzerland0.111111
sichuan province0.100000
research facility0.088435
caecum0.083333
state of new york0.083333
LOWER IN state of new york0.083333
female organism0.076923
oral cavity0.071429
LOWER IN antibiotic0.062500
wild0.041667
LOWER IN wild0.041667
china0.034884
LOWER IN control0.032432
control0.032432
feces0.031847
female0.031746
united states of america0.016194
LOWER IN research facility0.006803
Fraction of annotations for the query sequences containing the term
TermScore
rat0.969697
research facility0.954545
feces0.818182
rattus norvegicus0.787879
sprague dawley0.696970
china0.393939
male0.333333
united states of america0.272727
caecum0.242424
israel0.212121
rattus0.181818
control0.121212
female0.121212
control diet0.106061
LOWER IN control0.090909
ovariectomy0.090909
age 38 weeks0.090909
dahl salt-sensitive0.090909
switzerland0.090909
colitis0.075758
fructose diet0.060606
fructose0.060606
LOWER IN colitis0.045455
tnbs0.045455
commonwealth of massachusetts0.045455
city of boston0.045455
state of new york0.045455
new york city0.045455
wild0.045455
constipation0.045455
low capacity running strain0.045455
salt0.045455
salt rich diet0.045455
LOWER IN control diet0.045455
type i diabetes mellitus0.045455
induced type 1 diabetes0.045455
antibiotic0.045455
ampicillin0.045455
neomycin0.045455
oral cavity0.030303
sichuan province0.030303
female organism0.030303
LOWER IN fructose diet0.030303
LOWER IN fructose0.030303
parasitic helminthiasis infectious disease0.015152
hymenolepis diminuta0.015152
LOWER IN parasitic helminthiasis infectious disease0.015152
LOWER IN hymenolepis diminuta0.015152
LOWER IN tnbs0.015152
LOWER IN research facility0.015152
LOWER IN commonwealth of massachusetts0.015152
LOWER IN city of boston0.015152
LOWER IN state of new york0.015152
LOWER IN new york city0.015152
LOWER IN wild0.015152
LOWER IN constipation0.015152
high capacity running strain0.015152
LOWER IN low capacity running strain0.015152
LOWER IN high capacity running strain0.015152
sedentary0.015152
low physical activity0.015152
LOWER IN exercise0.015152
LOWER IN high physical activity0.015152
exercise0.015152
high physical activity0.015152
LOWER IN sedentary0.015152
LOWER IN low physical activity0.015152
LOWER IN salt0.015152
LOWER IN salt rich diet0.015152
LOWER IN sulfasalazine0.015152
sulfasalazine0.015152
LOWER IN type i diabetes mellitus0.015152
LOWER IN induced type 1 diabetes0.015152
LOWER IN antibiotic0.015152
LOWER IN ampicillin0.015152
LOWER IN neomycin0.015152
Exp. ID User ID Description Date Region Flag Sequences
434amnon high in control diet compared to fructose diet fructose in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 1
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 3
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 5
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 14
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
434amnon high in fructose diet fructose compared to control diet in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
419amnondominant feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 18
419amnonhigh freq. in rats with induced constipation (dominant feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 20
697amnondominant female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 20
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 20
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 20
442amnondominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 21
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 21
221amnondominant feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
349amnondominant feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 24
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 27
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 27
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 36
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 38
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 44
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 47
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 52
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 130
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 179
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 238
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470

Problems / suggestions? Please email info AT dbbact DOT org