Summary for ontology term: rectal swab

Number of annotations with term: 26

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGTAGAATTCCAGGT0.342857
GCGCGCAAATTACCCACTCCCGACCCGGGGAGGTAGTGACGAAAAATAACAATACAGGACTCTTTCGAGGCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTCGCGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGT0.250000
GCGCGCAAATTACCCATTACCGACACGGTGAGGTAGTGACGAAAAATAACAATACAGGTCTCTTTCGAGGCCCTGTAATTGGAATGAGCGTATCCTAAACCCATGGGTGAGGACCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTCC0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTCC0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__ActinobacillusTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTGGTGAGGAAGGTTGGCGTGTTAATAGCACGTTGACTTGACGTTAGCCACAGAAGAAGCACCGGC0.235294
d__Bacteria;p__"Bacteroidetes"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTGTTAAGTCAGCGGTCAAATGTCAGGGCCCAACCTTGGCATGCCGTTGATACTGGTGGTCTTGAATTCACACAAGGAAGGTGGAATTCGTCGT0.228571
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCAAGGAAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCTTACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT0.212766
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTTTTTAAGTCAGCTGTGAAAGTTCGGGGCTCAACCTTGAAATTGCAGTTGATACTGGAGACCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.196078
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__PhotobacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTAGGGAGGAAGGTAGTGTAGTTAACACCTGCATTATTTGACGTTACCTACAGAAGAAGCACCGGC0.195122

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
rectal swab0.800000
common bottlenose dolphin0.500000
LOWER IN age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
age 10-15 years0.500000
short beaked common dolphin0.500000
age 2-7 years0.500000
age 2 days0.500000
puppy0.500000
LOWER IN age 2 days0.500000
LOWER IN puppy0.500000
LOWER IN age 2-7 years0.500000
tursiops truncatus0.333333
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
delphinus delphis0.333333
LOWER IN adult organism0.250000
adult organism0.250000
age 8 weeks0.250000
LOWER IN age 8 weeks0.250000
homosexual0.166667
msm0.166667
macaca mulatta0.166667
LOWER IN hiv infection0.100000
hiv infection0.100000
french republic0.076923
female organism0.076923
LOWER IN female organism0.076923
italy0.050000
dog0.043478
infant0.038462
LOWER IN infant0.038462
canis lupus familiaris0.038462
male0.030303
feces0.012739
control0.005405
LOWER IN control0.005405
united states of america0.004049
homo sapiens0.003690
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
rectal swab1.000000
canis lupus familiaris0.384615
french republic0.384615
dog0.384615
puppy0.269231
homo sapiens0.230769
united states of america0.230769
male0.230769
homosexual0.230769
msm0.230769
macaca mulatta0.230769
cayo santiago0.230769
puerto rico0.230769
indian rhesus macaque0.230769
adult organism0.230769
italy0.153846
age 8 weeks0.153846
control0.115385
hiv infection0.115385
infant0.115385
age < 1 year0.115385
age 10-15 years0.115385
female organism0.115385
age 2-7 years0.115385
age 2 days0.115385
tursiops truncatus0.076923
common bottlenose dolphin0.076923
LOWER IN adult organism0.076923
delphinus delphis0.076923
short beaked common dolphin0.076923
LOWER IN age 8 weeks0.076923
LOWER IN hiv infection0.038462
LOWER IN control0.038462
LOWER IN age 10-15 years0.038462
LOWER IN infant0.038462
LOWER IN age &lt; 1 year0.038462
LOWER IN age 2 days0.038462
LOWER IN puppy0.038462
LOWER IN female organism0.038462
LOWER IN age 2-7 years0.038462
Exp. ID User ID Description Date Region Flag Sequences
766amnoncommon feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 12
666amnondominant feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 13
666amnondominant feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 13
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 18
563amnondominant feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 20
766amnondominant n in feces of dog females within 24h after parturition (dominant feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, rectal swab, age 2 days, puppy2021-04-12v4No1 / 20
766amnondominant feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 26
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
666amnoncommon feces, italy, delphinus delphis, rectal swab, short beaked common dolphin2020-09-25v3No1 / 48
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
666amnoncommon feces, tursiops truncatus, italy, rectal swab, common bottlenose dolphin2020-09-25v3No1 / 76
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v4No1 / 100
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396

Problems / suggestions? Please email info AT dbbact DOT org