Summary for ontology term: rectum

Number of annotations with term: 35

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.133333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.133333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.100000
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTGACAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGCCGGACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCAGCAAGTCAGAAGTGAAATCTCCGGGCTTAACCCGGAAACTGCTTTTGAAACTGTTGCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.285714
d__BacteriaTACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGACATGTAAGTCCGAGGTGAAAGACCGGGGCCCAACCCCGGGGTTGCCTCGGATACTGTGTGTCTGGAGTGGACGTGCCGCCGGGGGAATGAGTGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGTCGTGCAAGTCTGAAGTGAAATCCCTCGGCTCAACTGAGGAATTGCTTTGGAAACTATGCGACTTGAGTGCTGGAGAGGTAAGCGGAATTCCTGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__ButyrivibrioTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGTGATGCAAGTCTGAAGTGAAACCCCACGGCTCAACCGTGGGCTTGCTTTGGAAACTGTATGACTAGAGTACTGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGGCAAGTCAGATGTGAAAGGTGTGGGCTCAACTCACAAACTGCATTTGAAACTGTTTTGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATAGCAAGTCAGGTGTGAAATCTATGGGCTCAACCCATAAACTGCACTTGAAACTGTTGTTCTTGAGTGTCGGAGAGGTAGATGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGACGCGCAAGTCTGAAGTGAAAACCCACGGCTCAACTGTGGGCCTGCTTTGGAAACTGCGTATCTAGAGTGCCGGAGGGGCAAGCGGAATTCCTAG0.285714
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGATGCCAAGTCAGTTGTGAAAGTCCGCGGCTCAACCGTGGAATTGCAGTTGAAACTGGTATTCTTGAGTGTACATAACGAAGGTGGAATTTGTGG0.285714

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATCCTGTAGCTTAACTACAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.192308
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGCTTGCAAGTTGGAAGTGAAATCTCGGGGCTTAACCCCGAAACTGCTTTCAAAACTGCGAGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.184615
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTCATAAGTCAGTGGTGAAAAGCTGTGGCTCAACCATAGTCTTGCCGTTGAAACTGTGGAGCTTGAGTGCGGATGAGGTAGGCGGAACGCGTAG0.178571
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCGCGTCAAGCCGGTGGTAAAATTGCGGGGCTTAACCCCGTAGAGCCATCGGAACTGGCGTGCTTGAGTGGAGAAGAAGTATGCGGAATGCGAGGT0.171429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__OdoribacterTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTTAGTGGTTAAATGTTTGAGCTAAACTCAATACAGCCATTAATACTGGTAAACTGGAGTTCAGACGAGGTAGGCGGAATAAGTTAA0.171429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasCACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGTAGGCGGCCCGACAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGCCGGGCTAGAGTGCAGACGAGGTTGGCGGAACAGGTGAA0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTTCTTCAAGTCAGCTGTGAAAACGCGGGGCTCAACCTCGCGCCTGCAGTTGATACTGTTGAACTTGAGTGCACACAGGGATGTTGGAATTCATGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTCTGCAAGTTGGAAGTGAAACTCATGGGCTCAACCCATGAACTGCTTTCAAAACTGCGGATCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.166667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCAAGGAAAGTCTGATGTGAAAATGCGGAGCTCAACTCCGTATGGCGTTGGAAACTGCCTTACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT0.163265
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGTCTGAAGTGAAAACCCGAGGCTCAACCACGGGATTGCTTTGGAAACTGTCAAGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.153846

Annotations:

common ontology terms
term enrichment score
TermScore
rectum0.866966
colon0.568720
biopsy0.358209
LOWER IN rectum0.260870
ulcerative colitis0.222222
LOWER IN colon0.210526
ovis aries0.192771
dairy0.186047
mongolian sheep0.186047
children0.186047
santa catalina island0.186047
urocyon littoralis0.186047
urocyon littoralis catalinae0.186047
santa catalina island fox0.186047
age 30 days0.170213
intestinal mucosa0.166667
caecum0.164179
ileum0.162162
sigmoid colon0.156863
terminal ileum0.156863
perianal skin0.146341
LOWER IN ulcerative colitis0.127660
biopsy site0.127660
LOWER IN ileum0.117647
dog0.115385
obsolete_juvenile stage0.106667
canis lupus familiaris0.106195
ruminant reticulum0.102564
omasum0.102564
LOWER IN ruminant reticulum0.102564
LOWER IN omasum0.102564
duodenum0.086957
LOWER IN duodenum0.086957
LOWER IN caecum0.084507
gastrointestinal system0.081633
rumen0.072727
LOWER IN rumen0.072727
italy0.069565
human adult stage0.068966
poland0.065574
wild0.061069
crohn's disease0.055556
LOWER IN crohn's disease0.055556
LOWER IN perianal skin0.054054
severe0.054054
LOWER IN mild0.054054
mild0.054054
LOWER IN severe0.054054
esophagus0.051282
LOWER IN esophagus0.051282
external acoustic meatus0.051282
ear canal0.051282
LOWER IN external acoustic meatus0.051282
LOWER IN ear canal0.051282
LOWER IN biopsy site0.051282
united states of america0.046602
LOWER IN biopsy0.046512
child0.044693
stomach0.038462
LOWER IN stomach0.038462
mouth0.033898
LOWER IN mouth0.033898
homo sapiens0.028537
mus musculus0.024845
female0.024845
feces0.023715
china0.022250
adult0.021858
control0.019753
LOWER IN feces0.011461
LOWER IN control0.009091
Fraction of dbbact annotations with this term covered by the query
TermScore
colon1.666667
LOWER IN colon1.333333
crohn's disease1.000000
LOWER IN crohn's disease1.000000
rectum0.909091
LOWER IN rectum0.545455
dairy0.500000
ruminant reticulum0.500000
omasum0.500000
LOWER IN ruminant reticulum0.500000
LOWER IN omasum0.500000
mongolian sheep0.500000
children0.500000
perianal skin0.500000
santa catalina island0.500000
urocyon littoralis0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
LOWER IN perianal skin0.500000
severe0.500000
LOWER IN mild0.500000
mild0.500000
LOWER IN severe0.500000
biopsy0.375000
age 30 days0.333333
esophagus0.250000
LOWER IN esophagus0.250000
sigmoid colon0.250000
terminal ileum0.250000
external acoustic meatus0.250000
ear canal0.250000
LOWER IN external acoustic meatus0.250000
LOWER IN ear canal0.250000
LOWER IN biopsy site0.250000
ulcerative colitis0.250000
LOWER IN ulcerative colitis0.250000
biopsy site0.250000
intestinal mucosa0.200000
ileum0.187500
LOWER IN ileum0.187500
duodenum0.181818
LOWER IN duodenum0.181818
ovis aries0.166667
gastrointestinal system0.142857
LOWER IN biopsy0.125000
caecum0.111111
obsolete_juvenile stage0.100000
rumen0.100000
LOWER IN rumen0.100000
dog0.086957
LOWER IN caecum0.083333
canis lupus familiaris0.076923
poland0.076923
stomach0.058824
LOWER IN stomach0.058824
italy0.050000
human adult stage0.045455
mouth0.041667
LOWER IN mouth0.041667
wild0.041667
child0.027778
united states of america0.024291
mus musculus0.015873
female0.015873
homo sapiens0.014760
feces0.012739
china0.011628
adult0.011561
control0.010811
LOWER IN feces0.006369
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
rectum0.828571
united states of america0.571429
homo sapiens0.428571
colon0.342857
biopsy0.342857
caecum0.314286
china0.257143
ovis aries0.228571
adult0.200000
ulcerative colitis0.200000
LOWER IN rectum0.171429
feces0.171429
canis lupus familiaris0.171429
dog0.171429
ileum0.142857
intestinal mucosa0.142857
human adult stage0.142857
dairy0.114286
italy0.114286
obsolete_juvenile stage0.114286
age 30 days0.114286
LOWER IN colon0.114286
mongolian sheep0.114286
sigmoid colon0.114286
terminal ileum0.114286
children0.114286
control0.114286
wild0.114286
santa catalina island0.114286
urocyon littoralis0.114286
urocyon littoralis catalinae0.114286
santa catalina island fox0.114286
child0.114286
LOWER IN caecum0.085714
LOWER IN ileum0.085714
perianal skin0.085714
LOWER IN ulcerative colitis0.085714
biopsy site0.085714
ruminant reticulum0.057143
omasum0.057143
rumen0.057143
LOWER IN ruminant reticulum0.057143
LOWER IN omasum0.057143
LOWER IN rumen0.057143
duodenum0.057143
LOWER IN feces0.057143
gastrointestinal system0.057143
mus musculus0.057143
LOWER IN duodenum0.057143
female0.057143
poland0.057143
stomach0.028571
esophagus0.028571
mouth0.028571
LOWER IN stomach0.028571
LOWER IN esophagus0.028571
LOWER IN mouth0.028571
crohn's disease0.028571
LOWER IN control0.028571
LOWER IN crohn's disease0.028571
external acoustic meatus0.028571
ear canal0.028571
LOWER IN perianal skin0.028571
LOWER IN external acoustic meatus0.028571
LOWER IN ear canal0.028571
LOWER IN biopsy site0.028571
LOWER IN biopsy0.028571
severe0.028571
LOWER IN mild0.028571
mild0.028571
LOWER IN severe0.028571
Exp. ID User ID Description Date Region Flag Sequences
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
111amnondominant rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 13
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
310amnondominant feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 16
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
582amnondominant united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 23
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
856amnondominant homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 25
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
231amnonhigh freq. in dog rectum (dominant feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 29
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 48
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
111amnon high in ruminant reticulum omasum rumen compared to rectum caecum colon ileum in ovis aries mongolian sheep china 2017-04-09v4No1 / 294
13amnon high in feces rectum caecum colon compared to stomach esophagus duodenum ileum mouth in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 316
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
363amnon high in ruminant reticulum omasum rumen compared to rectum caecum colon in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 360
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464

Problems / suggestions? Please email info AT dbbact DOT org