Summary for ontology term: research facility

Number of annotations with term: 1077

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTCTTAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.002801
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCATGGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.002801
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Alcaligenaceae;g__AchromobacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGGAAAGAAAGATGTGAAATCCCAGAGCTTAACTTTGGAACTGCATTTTTAACTACCGAGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCG0.002801
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.001867
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.001867
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.001867
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.001867
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__RhizobiaceaeTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGAATTCCGAG0.001867
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGAGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGTGACTGCAAGGCTAGAGTACGGCAGAGGGGGGTGGAATTCCGCG0.001867
d__BacteriaTACAGGGGATGCAAGTGTTATCCGGAATTATTGGGCGTAAAGCGTCTGTAGGTTGATTTATAAGTCTTTTGTTAAATATTTAAGCTTAACTTAAAAAATGCAAAGGAAACTATTTATCTAGAGTTTGGTAGAGGTAAAGGGAATTTCCAG0.001867

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.375000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.375000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGAATGGAATTCCTGG0.375000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__BurkholderiaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTCCGCTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGGCGGGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG0.375000
TACGAGAGGGGTAAGCATTATTCATCATTAATGGGTCTAAAGGGTACGTAGGCTGTATCATAAGACTGGAAGGTATCGAACTAAATGAATAAGAGCTTTTCAGTAACTATGAAACTAGAGTGTAATGGAGGAAAGAGGAACTCCGAGAGT0.375000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__TerriglobusTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTTTGGCAAGTTTGGTGTGAAATCTTCGGGCTCAACTCGAAGTCTGCACCGAAAACTGCCGGGCTTGAGTATGGGAGAGGTGAGTGGAATTTCCGG0.375000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__RhodanobacterTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTAGTTAAGTCTGTCGTGAAATCCCCGGGCTCAACCTGGGAATGGCGATGGATACTGGCTGGCTAGAGTGTGTCAGAGGATGGTGGAATTTCCGG0.375000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Phyllobacteriaceae;g__AminobacterTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGTTAAGTTAGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGGCAATCTCGAGTCCGAGAGAGGTGAGTGGAATTCCGAG0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTATCGTGAAAGTCCGAGGCTCAACCTCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.375000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.265178
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.264591
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.258303
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.218978
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.214052
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.213655
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.213115
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTTGACAAGTCAGATGTGAAATCCTGCGGCTTAACCGCAGAACTGCATTTGAAACTGTTGATCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.201653
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.201529
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCACGGGCTCAACCCGTGAACTGCATTTGAAACTGTTTCCCTTGAGTGTCGGAGAGGTAATCGGAATTCCTTG0.198523

Annotations:

common ontology terms
term enrichment score
TermScore
research facility1.011838
mus musculus0.499053
mouse0.483749
united states of america0.325733
feces0.305081
c57bl/60.221305
caecum0.205907
china0.151637
male0.148873
female0.128412
rat0.126951
control0.120860
chicken0.118443
gallus gallus0.117862
digestive system0.106602
colon0.102765
LOWER IN control0.101028
rumen0.098304
sheep0.093318
ovis aries0.091608
rattus norvegicus0.090451
sprague dawley0.085333
c57bl/6j0.080684
australia0.078913
female organism0.077121
canada0.077088
fish0.076698
captive0.075082
macaca mulatta0.073012
state of texas0.072168
high fat diet0.071620
sweden0.071599
intestine0.069852
mouse chow0.067586
ileum0.067532
adult organism0.067283
age 6 weeks0.065342
canis lupus familiaris0.063607
monkey0.062647
jackson laboratories0.062621
bos taurus0.062275
sus scrofa0.060393
pig0.060393
rainbow trout0.057743
oncorhynchus mykiss0.057743
germany0.057266
diet0.055257
oryctolagus cuniculus0.053715
cecal content0.051897
united kingdom0.050433
balb/c0.048518
adult0.047604
rumen liquid0.046868
israel0.046201
western australia0.045022
dog0.044877
age 8 weeks0.044030
age 1 year0.043082
digesta0.042895
rhesus macaque0.042667
state of california0.042137
male organism0.040546
rabbit0.040036
holstein dairy cow0.039771
beagle dog0.039640
antibiotic0.039533
rattus0.038201
hen0.036243
japan0.036013
dentition0.035322
state of illinois0.034572
danio rerio0.034552
ruminal fluid0.034227
LOWER IN antibiotic0.034081
state of florida0.033417
age 2 months0.032742
charles river laboratories0.032698
jejunum0.032476
lamb0.032345
new zealand0.032086
oral cavity0.031830
control diet0.030662
skin0.029268
taconic farms0.029135
state of georgia0.028580
belgium0.028580
age 35 weeks0.028444
commonwealth of pennsylvania0.028310
cow0.027468
LOWER IN mouse chow0.027446
zebra fish0.027379
capra hircus0.027285
goat0.027285
larval stage0.026810
LOWER IN caecum0.026316
swiss webster0.025501
age 35 days0.025501
state of oregon0.025339
manchester0.025339
state of mississippi0.025339
Fraction of dbbact annotations with this term covered by the query
TermScore
research facility1.030864
c57bl/61.000000
sprague dawley1.000000
high fat diet1.000000
rabbit1.000000
meatmaster sheep1.000000
gauteng province1.000000
antimicrobial agent1.000000
antibiotics supllemented diet1.000000
LOWER IN antibiotics supllemented diet1.000000
ad libitum diet1.000000
LOWER IN farm21.000000
farm11.000000
LOWER IN farm11.000000
farm21.000000
damara sheep1.000000
LOWER IN damara sheep1.000000
LOWER IN meatmaster sheep1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
lumen of jejunum1.000000
LOWER IN jejunal mucosa1.000000
age 7 weeks1.000000
wuhan1.000000
LOWER IN lumen of jejunum1.000000
jejunal mucosa1.000000
LOWER IN mouse chow0.933333
LOWER IN high fat diet0.916667
mouse0.901639
mus musculus0.880597
jackson laboratories0.857143
rat0.833333
danio rerio0.833333
LOWER IN normal diet0.800000
mouse chow0.800000
ampicillin0.800000
age 2 months0.800000
zebra fish0.800000
rumen liquid0.800000
oryctolagus cuniculus0.750000
taconic farms0.750000
stress0.750000
LOWER IN stress0.750000
balb/c0.750000
LOWER IN fructose diet0.750000
LOWER IN fructose0.750000
fructose diet0.750000
fructose0.750000
holstein dairy cow0.750000
charles river laboratories0.750000
hen0.750000
c57bl/6j0.727273
rattus norvegicus0.714286
cecal content0.714286
rex rabbit0.666667
age 9 weeks0.666667
age 18 weeks0.666667
low fat diet0.666667
LOWER IN low fat diet0.666667
beagle dog0.666667
chicken0.666667
ovariectomy0.666667
age 42 days0.666667
LOWER IN fasting0.666667
oreochromis niloticus0.666667
juvenile0.666667
age 6 weeks0.666667
age 1 month0.666667
bombus terrestris0.666667
hymenolepis diminuta0.666667
LOWER IN hymenolepis diminuta0.666667
wistar rat0.666667
capra hircus0.666667
goat0.666667
age 140 days0.666667
humanized mouse0.666667
age 21 days0.666667
LOWER IN iron deficient diet0.666667
iron supplemented diet0.666667
LOWER IN iron supplemented diet0.666667
iron deficient diet0.666667
swiss webster0.666667
ictalurus punctatus0.666667
channel catfish0.666667
restricted feed0.666667
LOWER IN restricted feed0.666667
age 35 days0.666667
LOWER IN age 5 weeks0.666667
age 5 weeks0.666667
fishmeal diet0.666667
state of iowa0.666667
osteopilus septentrionalis0.666667
LOWER IN age 18 weeks0.666667
age 70 days0.666667
LOWER IN western diet0.666667
western diet0.666667
gallus gallus0.631579
caecum0.619048
antibiotic0.611111
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.993500
feces0.435469
united states of america0.428969
mus musculus0.348189
mouse0.330548
china0.129062
c57bl/60.124420
caecum0.123491
male0.090994
female0.082637
control0.078923
rat0.068709
chicken0.064995
gallus gallus0.064995
LOWER IN control0.063138
digestive system0.063138
colon0.057567
rumen0.054782
ovis aries0.051996
sheep0.051996
canada0.050139
australia0.050139
rattus norvegicus0.048282
captive0.044568
sprague dawley0.044568
adult0.042711
c57bl/6j0.042711
fish0.041783
sweden0.041783
female organism0.041783
state of texas0.039926
macaca mulatta0.038997
canis lupus familiaris0.038997
intestine0.038069
monkey0.037140
high fat diet0.037140
germany0.037140
adult organism0.037140
ileum0.036212
bos taurus0.036212
mouse chow0.035283
age 6 weeks0.034355
sus scrofa0.033426
pig0.033426
jackson laboratories0.032498
rainbow trout0.030641
oncorhynchus mykiss0.030641
diet0.029712
united kingdom0.029712
oryctolagus cuniculus0.027855
dog0.027855
cecal content0.026927
state of california0.025998
balb/c0.025070
israel0.025070
age 8 weeks0.024141
rumen liquid0.024141
age 1 year0.024141
western australia0.024141
digesta0.022284
rhesus macaque0.022284
male organism0.021356
antibiotic0.020427
dentition0.020427
beagle dog0.020427
rabbit0.020427
rattus0.020427
holstein dairy cow0.020427
japan0.019499
state of florida0.018570
hen0.018570
state of illinois0.018570
LOWER IN antibiotic0.017642
danio rerio0.017642
ruminal fluid0.017642
skin0.016713
age 2 months0.016713
lamb0.016713
new zealand0.016713
jejunum0.016713
oral cavity0.016713
charles river laboratories0.016713
control diet0.015785
taconic farms0.014856
state of georgia0.014856
commonwealth of pennsylvania0.014856
belgium0.014856
cow0.014856
age 35 weeks0.014856
LOWER IN mouse chow0.013928
LOWER IN caecum0.013928
zebra fish0.013928
larval stage0.013928
capra hircus0.013928
goat0.013928
rhizosphere0.013928
subgingival plaque0.012999
south korea0.012999
state of oregon0.012999
manchester0.012999
Exp. ID User ID Description Date Region Flag Sequences
434amnon high in control diet compared to fructose diet fructose in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 1
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 1
108amnonquail mitochondria (other state of texas, research facility, united states of america, colon, quail, coturnix coturnix)2017-04-07v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in bisphenol a estradiol compared to control in danio rerio zebra fish intestine research facility china )2017-04-09v4No1 / 1
114amnondominant rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 1
114amnon high in control compared to polychlorinated biphenyl 126 pcb contaminated water in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in high neutrophils neutrophil hirschsprung disease compared to low neutrophils control in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to hirschsprung disease high neutrophils neutrophil in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
230amnondominant mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 1
244amnon high in cmy diet diet compared to starch diet in drosophila melanogaster fruit fly research facility digestive system united kingdom 2017-11-15v4No1 / 1
244amnon high in diet starch diet compared to cmy diet in drosophila melanogaster fruit fly research facility digestive system united kingdom 2017-11-15v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 1
351amnondominant bacteria in sea urchin gut (dominant sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system)2018-07-30v4No1 / 1
809amnondominant dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
604amnon high in infectious bronchitis virus bronchitis compared to control in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 2
114amnon high in polychlorinated biphenyl 126 pcb contaminated water compared to control in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 2
313amnon high in fishmeal diet compared to yeast diet in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system 2018-04-10v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in diet linoleic acid compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 3
313amnonlower in gut content of fish grown in 12C compared to 18C water ( high in warm temperature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 3
313amnonlower in gut mucosa of fish grown in 12C compared to 18C water ( high in warm termpterature habitat 18c compared to 12c cold environment in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 3
315amnonlower in captive grown compared to wild frogs ( high in wild compared to research facility in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 3
809amnondominant lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 3
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
108amnondecreases during fasting in nile tilapia colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 4
923amnondominant japan, rat, sprague dawley, rattus norvegicus, oral cavity, research facility2022-07-27v3No1 / 4
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in rattus rat sprague dawley research facility caecum united states of america )2017-08-23v4No1 / 5
255amnondominant catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 5
313amnonhigh freq. in rainbow trout gut content grown in 18C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in caloric restriction diet diet compared to control in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, rumen, research facility2022-05-18v3No1 / 5
431amnonhigh freq. in midgut of non-hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, no hibernation, belgium)2018-12-16v4No1 / 5
431amnonlower in midgut of hibernating bumble bees compared to non-hibernating ( high in non hibernating compared to hibernation in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 5
913amnon high in control diet compared to yeast supplemented diet yeast (food source) in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 5
108amnondominant state of texas, research facility, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 6
108amnondominant state of texas, research facility, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 6
112amnondominant danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
649amnondominant jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 6
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 6
263amnonhigh freq. in desert soil irrigated daily in lab (dominant soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 6
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 6
795amnoncommon uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 6
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, rumen, juvenile stage, research facility2022-05-20v1No1 / 6
929amnondominant damara sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 6
933amnondominant quaternary laterite soil, pumpkin, cucurbita moschata, china, ph 5.5, guangxi zhuang autonomous region, rhizosphere, research facility2022-09-11v3No1 / 6
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
632amnondominant caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 7
179amnondominant mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 7
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in chest skin adult organism captive austria research facility 2022-03-12v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
483amnondominant hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 7
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in liolaemus ruibali argentina research facility small intestine )2017-02-25v4No1 / 8
592amnondominant united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 8
929amnondominant meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 8
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
181amnondominant bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 8
687amnondominant shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 8
701amnondominant municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 8
230amnoncommon mouse, mus musculus, research facility, united states of america, upper respiratory tract2017-11-02v4No1 / 8
255amnoncommon catfish, digestive system, united states of america, state of minnesota, research facility, ictalurus punctatus, channel catfish2017-11-24v4No1 / 8
262amnondominant tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 8
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, warm temperature habitat, 18c, gastrointestinal system mucosa)2018-04-10v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
879amnon high in wolf canis lupus compared to dog canis lupus familiaris in adult organism chest captive austria skin research facility 2022-03-12v4No1 / 8
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, abomasum, research facility2022-05-18v3No1 / 8
431amnoncommon in midgut of non-hibernating bumble bees (common bombus terrestris, bumble bee, midgut, research facility, queen, no hibernation, belgium)2018-12-16v4No1 / 8
463amnondominant intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 8
483amnondominant hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 8
483amnondominant hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 8
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 9
108amnondominant state of texas, research facility, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 9
649amnondominant ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 9
687amnondominant chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 9
244amnondominant drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 9
741amnondominant pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 9
744amnondominant ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 9
308amnondominant red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 9
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 9
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 9
421amnonhigh freq. in paddy field soil incubated without copper (dominant soil, research facility, zhejiang province, paddy field soil, china)2018-12-02v4No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, colon, research facility2022-05-18v3No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, ileum, research facility2022-05-18v3No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, jejunum, research facility2022-05-18v3No1 / 9
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden 2019-02-27v4No1 / 9
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 10
69amnondominant canis lupus familiaris, beagle dog, research facility, united states of america, nasal cavity2017-02-21v4No1 / 10
71amnondominant liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
700amnon high in caecum compared to colon in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
632amnondominant feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 10
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 10
117amnondominant zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
649amnondominant duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 10
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 10
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
255amnoncommon in fish feed (dominant united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
308amnondominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 10
780amnondominant jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 10
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 10
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 10
808amnondominant caecum, digesta, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 10
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, caecum, research facility2022-05-18v3No1 / 10
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, research facility, feces2022-05-18v3No1 / 10
910amnondominant age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 10
916amnondominant rabbit, age 2 months, kingdom of spain, oryctolagus cuniculus, caecum, research facility2022-07-04v4No1 / 10
481amnondominant united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 10
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 11
264amnondominant oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 11
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 11
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, digestive system2018-07-30v4No1 / 11
808amnondominant caecum, mucosa, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 11
879amnondominant adult organism, chest, captive, dog, austria, canis lupus familiaris, skin, research facility2022-03-12v4No1 / 11
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 11
913amnon high in yeast (food source) yeast supplemented diet compared to control diet in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 11
446amnondominant fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 12
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
71amnondominant liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
108amnoncommon state of texas, research facility, united states of america, caecum, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 12
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 12
657amnondominant research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 12
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 12
308amnondominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in diet control compared to caloric restriction diet in mus musculus mouse c57bl/6 ldlr- high fat diet research facility united states of america state of washington )2018-04-29v4No1 / 12
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water, aquarium)2018-07-30v4No1 / 12
817amnondominant bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 12
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 12
879amnondominant wolf, canis lupus, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 12
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 12
903amnondominant spontaneously fermented red wine, grape based wine or wine-like food product, wine food product, poland, research facility2022-05-06v3No1 / 12
913amnondominant sichuan white goose, age 70 days, municipality of chongqing, china, goose, cecal content, bird, anser cygnoides, caecum, research facility2022-06-01v3No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
604amnondominant caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 13
611amnon high in male compared to female in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 13
108amnon high in colon compared to caecum in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 13
649amnondominant colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 13
165amnonhigh freq. in house fly larva grown on moist wheat bran (dominant research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
187amnondominant rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
710amnondominant mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 13
748amnondominant jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
748amnondominant holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
308amnondominant red abalone, haliotis rufescens, united states of america, state of california, research facility, foot2018-03-30v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gastrointestinal system mucosa, 12c, cold environment)2018-04-10v4No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
795amnoncommon vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 13
808amnondominant ileal mucosa, mucosa, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 13
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 13
421amnonhigh freq. in paddy field soil incubated with copper (dominant soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 13
903amnoncommon spontaneously fermented red wine, research facility, poland, grape based wine or wine-like food product, wine food product2022-05-06v3No1 / 13
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
622amnondominant caecum, age 42 days, research facility, liverpool, great britain, chicken, gallus gallus2020-05-08v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 14
673amnondominant control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 14
186amnondominant rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 14
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
748amnondominant jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 14
308amnondominant red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 14
399amnondominant feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 14
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v4No1 / 14
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 14
25amnon high in compared to in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 15
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 15
613amnondominant olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 15
107amnondominant state of texas, research facility, united states of america, colon, eublepharis macularius, leopard gecko2017-04-07v4No1 / 15
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
673amnoncommon salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 15
687amnondominant chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 15
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 15
300amnondominant rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 15
308amnonhigh freq. in water of aquarium with red abalone (dominant red abalone, haliotis rufescens, united states of america, state of california, research facility, water, sea water, aquarium)2018-03-30v4No1 / 15
308amnondominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 15
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gastrointestinal system mucosa )2018-04-10v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
326amnondominant mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
808amnondominant digesta, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 15
358amnondominant rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 15
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
392amnondominant fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, pre pupae insect diet2018-11-05v4No1 / 15
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
860amnondominant duck, china, intestinal contents, anas platyrhynchos, intestine, research facility2022-01-12v3No1 / 15
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, duodenum, research facility2022-05-18v3No1 / 15
910amnondominant holstein dairy cow, age 42 days, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
934amnondominant age 7 weeks, wuhan, china, jejunal mucosa, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, lumen of jejunum, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 15
494amnondominant mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 16
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 16
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
604amnon high in control compared to infectious bronchitis virus bronchitis in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 16
108amnondominant state of texas, research facility, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
710amnondominant ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 16
719amnondominant charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 16
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 16
324amnondominant australia, gryllinae, field cricket, midgut, colon, digestive system, research facility2018-04-27v4No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
416amnondominant termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 16
893amnondominant silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 16
904amnondominant age 42 weeks, jinghong-1, hen, china, chicken, gallus gallus, caecum, research facility2022-05-18v3No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
471amnondominant digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 16
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
71amnondominant liolaemus ruibali, argentina, research facility, feces2017-02-25v4No1 / 17
611amnondominant caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 17
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 17
116amnondominant research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 17
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in charles river laboratories icr/cd-1 mice state of georgia united states of america research facility dentition mus musculus mouse )2028-05-23v4No1 / 17
283amnondominant pycnoscelus surinamensis, cockroach, burrowing cockroach, research facility, kingdom of denmark, hindgut, digestive system2018-01-25v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility low capacity running strain 2018-02-27v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
776amnondominant caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 17
351amnondominant sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
897amnondominant adelaide, broiler chicken, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 17
897amnondominant isa brown, layer chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 17
912amnondominant zebra mussel, dreissena polymorpha, fresh water aquarium, mussel, whole body, body proper, research facility2022-05-27v4No1 / 17
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 17
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 18
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 18
649amnon high in jejunum duodenum compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 18
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 18
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
739amnondominant age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 18
744amnondominant cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 18
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 18
780amnondominant caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 18
795amnondominant cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 18
351amnondominant sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 18
817amnondominant united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus colonic mucosa research facility 2022-05-20v3No1 / 18
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 18
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
671amnondominant age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in chemically defined diet diet compared to cat chow in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 19
795amnoncommon cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 19
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 19
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v4No1 / 19
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (dominant bombus terrestris, bumble bee, midgut, research facility, queen, belgium, hibernation)2018-12-16v4No1 / 19
463amnoncommon intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 19
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 20
434amnondominant rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 20
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 20
614amnonincreases in picher plant fluid grown in lab ( high in research facility days 57-60 late time points compared to wild days 0-3 early time points in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 20
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 20
671amnondominant age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 20
697amnondominant sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 20
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 20
322amnondominant frog, osteopilus septentrionalis, united states of america, state of florida, research facility, digestive system, tadpole2018-04-23v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
818amnondominant ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 20
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 20
826amnondominant age 4 years, subgingival dental plaque, adult organism, female organism, dog, subgingival plaque, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 20
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 20
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v3No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 21
69amnondominant united states of america, canis lupus familiaris, beagle dog, research facility, oropharynx2017-02-21v4No1 / 21
108amnondominant state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 21
108amnondominant quail, state of texas, research facility, united states of america, caecum, coturnix coturnix2017-04-07v4No1 / 21
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 21
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 21
741amnondominant alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 21
744amnondominant caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 21
759amnondominant city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 21
853amnondominant solid food diet, soild food supplemented diet, hyplus rabbit, age 5 weeks, juvenile, caecum, rabbit, cecal content, french republic, oryctolagus cuniculus, research facility2021-12-20v3No1 / 21
879amnondominant adult organism, captive, dog, austria, canis lupus familiaris, research facility, feces2022-03-12v4No1 / 21
893amnondominant sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 21
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
483amnondominant larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 21
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 22
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in caecum mouse mus musculus canada research facility age 9 months cecal content female 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
673amnondominant caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 22
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
795amnondominant uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v3No1 / 22
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
61amnondominant canis lupus familiaris, united states of america, skin, inguinal region, research facility2017-02-05v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
71amnondominant liolaemus ruibali, colon, hindgut, argentina, research facility2017-02-25v4No1 / 23
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to late timepoints age 35 weeks age in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 23
795amnondominant vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 23
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 23
392amnon high in fishmeal diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 23
853amnon high in age 3 weeks compared to age 5 weeks in exclusive breastmilk diet juvenile cecal content caecum hyplus rabbit rabbit oryctolagus cuniculus french republic research facility 2021-12-18v3No1 / 23
934amnon high in lumen of jejunum compared to jejunal mucosa in jejunum age 7 weeks wuhan research facility gallus gallus chicken china 2022-09-18v3No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 24
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
756amnondominant caecum, lethbridge, age 35 days, canada, broiler chicken, research facility, gallus gallus, chicken2021-03-22v4No1 / 24
322amnondominant frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 24
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 24
826amnondominant age 4 years, supragingival dental plaque, adult organism, female organism, supragingival plaque, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 24
392amnon high in fishmeal diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 24
853amnondominant exclusive breastmilk diet, hyplus rabbit, juvenile, age 3 weeks, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-18v3No1 / 24
853amnondominant exclusive breastmilk diet, hyplus rabbit, age 5 weeks, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v3No1 / 24
916amnon high in restricted feed compared to control diet in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 24
447amnondominant mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 24
923amnoncommon oral cavity, japan, research facility, sprague dawley, rattus norvegicus, rat2022-07-27v3No1 / 24
471amnondominant digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 24
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 25
108amnondominant state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 25
181amnoncommon bombus terrestris, bumblebee, belgium, research facility, digestive system2017-08-15v4No1 / 25
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in fish zebrafish danio rerio research facility larvae age 15d united states of america )2019-01-08v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 26
114amnondominant rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 26
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
826amnondominant age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, saliva, research facility, united states of america2021-08-22v4No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 26
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 27
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 27
838amnondominant wild turkey, meleagris gallopavo, state of ohio, caecum, research facility, united states of america2021-10-13v4No1 / 27
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
916amnon high in ad libitum diet control diet compared to restricted feed in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
741amnoncommon pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 28
817amnoncommon bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high protein diet, meat diet2021-08-29v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
622amnon high in ileum compared to caecum in age 42 days research facility liverpool great britain chicken gallus gallus 2020-05-08v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum mus musculus mouse )2017-04-07v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 29
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 29
817amnon high in bronchoalveolar lavage lung compared to saliva oral wash cheek pouch oral cavity in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, hydrolized diet2021-08-29v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high fiber2021-08-29v4No1 / 29
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 31
262amnoncommon tick, ixodes scapularis, larval stage, body proper, research facility2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
446amnoncommon fish, zebrafish, danio rerio, research facility, larvae, age 15d, united states of america2019-01-08v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
392amnon high in larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 32
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 32
905amnon high in jejunum compared to ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 33
611amnon high in female compared to male in caecum mouse mus musculus canada research facility age 9 months cecal content 2020-04-21v4No1 / 33
108amnonincreases during fasting in quail caecum ( high in fasting late timepoints compared to early timepoints in quail state of texas research facility united states of america caecum coturnix coturnix )2017-04-07v4No1 / 33
668amnon high in age 4 months compared to age 5 years in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 33
187amnonpositively correlated with age 25-35 weeks ( high in late time points age 35 weeks compared to early time points 25 weeks in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v3No1 / 33
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 34
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, fishmeal diet2018-11-05v4No1 / 34
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 34
108amnoncommon state of texas, research facility, united states of america, colon, quail, coturnix coturnix2017-04-07v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in tick ixodes scapularis larval stage body proper research facility )2017-12-10v4No1 / 35
897amnon high in broiler chicken compared to isa brown layer chicken in male caecum age 4 weeks adelaide research facility australia gallus gallus chicken 2022-04-18v3No1 / 35
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 36
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 37
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 38
649amnoncommon jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 38
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 38
744amnoncommon ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
909amnon high in age 6 weeks compared to age 18 weeks in colonic mucosa manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 39
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
700amnon high in control compared to tylosin phosphate antibiotic in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v3No1 / 41
614amnondecreases in picher plant fluid grown in lab ( high in wild early time points days 0-3 compared to research facility late time points days 57-60 in harvard forest plant fluid pitcher fluid united states of america commonwealth of massachusetts pitcher plant sarracenia purpurea )2020-04-26v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 42
108amnoncommon state of texas, research facility, united states of america, colon, oreochromis niloticus, nile tilapia2017-04-07v4No1 / 43
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 43
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, bronchoalveolar lavage2017-02-21v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 45
108amnonincreases during fasting in southern frog colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon anaxyrus terrestris southern toad )2017-04-07v4No1 / 45
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
649amnoncommon duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 45
244amnoncommon drosophila melanogaster, fruit fly, research facility, digestive system, united kingdom2017-11-15v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 45
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
879amnon high in dog canis lupus familiaris compared to wolf canis lupus in captive adult organism austria research facility feces 2022-03-12v4No1 / 45
912amnon high in whole body body proper zebra mussel dreissena polymorpha mussel compared to fresh water aquarium water in state of minnesota united states of america fresh water aquarium research facility 2022-05-27v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 46
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 47
744amnon high in ileum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 47
853amnon high in exclusive breastmilk diet compared to solid food diet soild food supplemented diet in hyplus rabbit age 5 weeks juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-20v3No1 / 47
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 47
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 49
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 49
853amnon high in age 5 weeks compared to age 3 weeks in exclusive breastmilk diet hyplus rabbit juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-18v3No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 51
324amnonlower in crickets fed chemically defined diet compared to cat chow diet ( high in cat chow diet compared to chemically defined diet in australia gryllinae field cricket midgut colon digestive system research facility )2018-04-27v4No1 / 51
392amnon high in larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in rat rattus norvegicus caecum female ovariectomy age 38 weeks united states of america research facility 2018-02-27v4No1 / 52
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
416amnon high in fasting compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 52
897amnon high in isa brown layer chicken compared to broiler chicken in adelaide age 4 weeks chicken australia male gallus gallus caecum research facility 2022-04-18v3No1 / 52
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 53
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 53
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
649amnoncommon ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon fish, oncorhynchus mykiss, rainbow trout, digestive system, sweden, research facility, larvae insect diet2018-11-05v4No1 / 55
817amnon high in oral cavity cheek pouch oral wash saliva compared to bronchoalveolar lavage lung in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
808amnoncommon ileal mucosa, mucosa, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 58
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
392amnon high in defatted larvae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 59
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
416amnon high in wood diet compared to fasting in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 59
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
586amnon high in control diet compared to fructose diet fructose in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 61
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
905amnon high in ileum compared to jejunum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 61
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
657amnonpostively correlated with age ( high in older age age compared to younger age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 65
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
326amnon high in diet high fat diet compared to mouse chow in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 65
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in caecum mouse mus musculus canada research facility age 9 months cecal content )2020-04-21v4No1 / 66
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v4No1 / 67
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
744amnon high in cloaca compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 70
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 70
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 70
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 71
853amnon high in soild food supplemented diet solid food diet compared to exclusive breastmilk diet in hyplus rabbit age 5 weeks juvenile rabbit cecal content french republic oryctolagus cuniculus caecum research facility 2021-12-20v3No1 / 71
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
808amnoncommon digesta, ileum, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 72
817amnoncommon united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v3No1 / 72
879amnoncommon canis lupus familiaris, dog, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
934amnon high in jejunal mucosa compared to lumen of jejunum in age 7 weeks wuhan china chicken gallus gallus jejunum research facility 2022-09-18v3No1 / 72
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
697amnoncommon sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 73
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 73
934amnoncommon lumen of jejunum, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 73
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 75
719amnoncommon charles river laboratories, icr/cd-1 mice, state of georgia, united states of america, research facility, dentition, mus musculus, mouse2028-05-23v4No1 / 75
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in quail state of texas research facility united states of america caecum coturnix coturnix )2017-04-07v4No1 / 76
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 76
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in bombus terrestris bumble bee midgut research facility queen belgium )2018-12-16v4No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
905amnon high in abomasum compared to rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 78
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 79
324amnoncommon australia, gryllinae, field cricket, midgut, colon, digestive system, research facility2018-04-27v4No1 / 79
822amnon high in high fiber compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 79
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
108amnon high in caecum compared to colon in state of texas research facility united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 80
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in state of texas research facility united states of america colon oreochromis niloticus nile tilapia )2017-04-07v4No1 / 81
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 81
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 82
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 82
853amnoncommon age 3 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-18v3No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 85
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
494amnon high in diet western diet high fat diet compared to mouse chow in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 85
108amnon high in caecum compared to colon in state of texas research facility united states of america mus musculus mouse 2017-04-07v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
822amnon high in hydrolized diet compared to high fiber in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 88
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 88
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
904amnoncommon age 42 weeks, research facility, china, jinghong-1, hen, caecum, gallus gallus, chicken2022-05-18v3No1 / 89
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
649amnon high in ileum compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 92
668amnon high in age 5 years compared to age 4 months in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 92
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 94
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
838amnoncommon state of ohio, united states of america, research facility, caecum, wild turkey, meleagris gallopavo2021-10-13v4No1 / 94
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 95
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 96
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v3No1 / 96
853amnoncommon age 5 weeks, exclusive breastmilk diet, hyplus rabbit, juvenile, rabbit, cecal content, french republic, oryctolagus cuniculus, caecum, research facility2021-12-20v3No1 / 96
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
912amnon high in dead compared to alive in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 100
483amnoncommon larval stage, hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america2019-02-13v4No1 / 100
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 102
108amnon high in colon compared to caecum in state of texas research facility united states of america oreochromis niloticus nile tilapia 2017-04-07v4No1 / 103
822amnon high in meat diet high protein diet compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 103
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in mus musculus mouse caecum c57bl/6 research facility charles river laboratories united states of america state of maryland )2019-01-08v4No1 / 106
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 107
776amnon high in feral wild age 15-20 weeks compared to age 5 weeks research facility broiler chicken captive in caecum hawaii chicken gallus gallus 2021-04-25v3No1 / 107
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 110
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 110
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
912amnoncommon fresh water aquarium, research facility, whole body, body proper, zebra mussel, dreissena polymorpha, mussel2022-05-27v4No1 / 112
71amnoncommon liolaemus ruibali, feces, argentina, research facility2017-02-25v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
744amnoncommon cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 114
853amnoncommon soild food supplemented diet, solid food diet, hyplus rabbit, age 5 weeks, juvenile, caecum, rabbit, cecal content, french republic, oryctolagus cuniculus, research facility2021-12-20v3No1 / 114
905amnoncommon jejunum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 114
416amnon high in wood diet compared to mulch diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 115
613amnoncommon olsztyn, poland, aquarium, research facility, gastrointestinal system, gut, esox lucius, pike fry, fish2020-04-25v3No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
822amnon high in high fiber compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 118
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 119
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america colon mus musculus mouse )2017-04-07v4No1 / 120
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 120
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
744amnon high in ileum compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in state of texas research facility united states of america caecum oreochromis niloticus nile tilapia )2017-04-07v4No1 / 122
326amnoncommon mus musculus, mouse, c57bl/6, ldlr-, research facility, united states of america, state of washington, high fat diet2018-04-29v4No1 / 122
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 122
741amnon high in alfalfa diet compared to pellet feed diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 123
822amnon high in meat diet high protein diet compared to high fiber in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 123
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
649amnoncommon colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 128
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 129
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 130
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
108amnoncommon state of texas, research facility, united states of america, colon, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
176amnoncommon in skin of hairless mice (common mouse, mus musculus, skin, female, skh-1 hairless mouse, dorsum, research facility, united states of america)2017-07-29v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 134
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in tapwater irrigation fertilized water irrigation treated wastewater irrigation compared to artificial wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 134
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v3No1 / 135
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
897amnoncommon broiler chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
905amnoncommon ileum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 137
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 140
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
893amnoncommon silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 140
710amnoncommon ketogenic diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 141
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
741amnoncommon alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 141
744amnoncommon caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 141
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
893amnoncommon sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 142
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
71amnoncommon liolaemus ruibali, colon, hindgut, argentina, research facility2017-02-25v4No1 / 144
897amnoncommon isa brown, layer chicken, adelaide, age 4 weeks, chicken, australia, male, gallus gallus, caecum, research facility2022-04-18v3No1 / 144
611amnoncommon caecum, mouse, mus musculus, canada, research facility, age 9 months, cecal content2020-04-21v4No1 / 145
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
822amnoncommon hydrolized diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, tadpole, state of florida2019-01-14v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
300amnoncommon rat, rattus norvegicus, caecum, female, ovariectomy, age 38 weeks, united states of america, research facility2018-02-27v4No1 / 150
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 150
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
710amnoncommon mouse chow, control diet, state of california, swiss webster, research facility, united states of america, mus musculus, mouse2028-05-20v4No1 / 151
822amnoncommon meat diet, high protein diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 151
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
822amnoncommon high fiber, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 153
392amnon high in pre pupae insect diet compared to fishmeal diet in fish oncorhynchus mykiss rainbow trout digestive system sweden research facility 2018-11-05v4No1 / 153
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 154
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 154
912amnon high in aquarium water fresh water compared to body proper whole body mussel zebra mussel dreissena polymorpha in fresh water aquarium state of minnesota research facility united states of america 2022-05-27v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
108amnon high in colon compared to caecum in quail state of texas research facility united states of america coturnix coturnix 2017-04-07v4No1 / 157
108amnoncommon state of texas, research facility, united states of america, colon, mus musculus, mouse2017-04-07v4No1 / 158
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 161
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, digestive system, tadpole2018-04-23v4No1 / 161
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 161
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, western diet, high fat diet2019-02-27v4No1 / 161
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 163
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 163
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, caecum2019-01-10v4No1 / 167
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 168
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, colonic mucosa, research facility2022-05-20v3No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v3No1 / 170
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
759amnoncommon city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 179
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, ileum, terminal ileum, jackson laboratories2019-07-30v4No1 / 182
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
107amnoncommon state of texas, research facility, united states of america, colon, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
604amnoncommon caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 185
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, jackson laboratories, colon, right colon2019-07-30v4No1 / 186
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
744amnon high in caecum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 187
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 188
326amnon high in diet mouse chow compared to high fat diet in mus musculus mouse c57bl/6 ldlr- research facility united states of america state of washington 2018-04-29v4No1 / 189
860amnoncommon china, research facility, duck, anas platyrhynchos, intestine, intestinal contents2022-01-12v3No1 / 190
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 190
910amnoncommon age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 191
808amnon high in digesta compared to ileal mucosa mucosa in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 192
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
826amnoncommon supragingival plaque, supragingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 195
592amnoncommon united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 196
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v4No1 / 196
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
905amnoncommon duodenum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
910amnoncommon age 42 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 202
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
913amnoncommon municipality of chongqing, china, research facility, cecal content, caecum, age 70 days, bird, anser cygnoides, sichuan white goose, goose2022-06-01v3No1 / 206
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
481amnoncommon united states of america, state of alabama, research facility, water, fresh water, pond water, fishpond2019-02-12v4No1 / 210
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 211
780amnon high in caecum compared to jejunum duodenum small intestine in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 212
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 212
826amnoncommon dentition, subgingival plaque, subgingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, research facility, united states of america2021-08-22v4No1 / 215
108amnoncommon quail, state of texas, research facility, united states of america, caecum, coturnix coturnix2017-04-07v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
759amnon high in commonwealth of massachusetts city of boston research facility compared to wild state of new york new york city in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
808amnon high in ileum compared to caecum in digesta germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 224
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 225
916amnon high in antimicrobial agent antibiotics supllemented diet antibiotic compared to normal diet control in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
929amnon high in meatmaster sheep compared to damara sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 231
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 232
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
826amnoncommon state of illinois, united states of america, saliva, research facility, age 4 years, adult organism, female organism, beagle dog, dog, canis lupus familiaris2021-08-22v4No1 / 233
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v4No1 / 238
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
308amnoncommon in water of aquarium with red abalone (common red abalone, haliotis rufescens, united states of america, state of california, research facility, water, sea water, aquarium)2018-03-30v4No1 / 240
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, oropharynx2017-02-21v4No1 / 241
108amnoncommon state of texas, research facility, united states of america, caecum, mus musculus, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, shelled egg2019-02-13v4No1 / 243
622amnoncommon caecum, age 42 days, research facility, liverpool, great britain, chicken, gallus gallus2020-05-08v4No1 / 244
910amnoncommon mouth mucosa, oral cavity, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 245
916amnon high in control diet control compared to antibiotics supllemented diet antibiotic in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 246
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
776amnon high in broiler chicken captive research facility age 5 weeks compared to wild feral age 15-20 weeks in caecum gallus gallus chicken hawaii 2021-04-25v3No1 / 252
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
71amnon high in feces colon hindgut compared to small intestine stomach in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 255
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
308amnoncommon red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 258
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
905amnon high in rumen compared to abomasum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 264
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
744amnon high in cloaca compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 265
808amnon high in digesta compared to mucosa in caecum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 266
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
494amnoncommon mus musculus, mouse, research facility, c57bl/6, male, charles river laboratories, sweden, colon, mouse chow2019-02-27v4No1 / 275
910amnon high in age 70 days compared to age 140 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 276
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
744amnon high in caecum compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 286
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
494amnon high in mouse chow compared to diet western diet high fat diet in mus musculus mouse research facility c57bl/6 male charles river laboratories sweden colon 2019-02-27v4No1 / 293
780amnoncommon caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 294
649amnon high in jejunum duodenum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 295
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
910amnon high in age 140 days compared to age 70 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 302
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
622amnon high in caecum compared to ileum in age 42 days research facility liverpool great britain chicken gallus gallus 2020-05-08v4No1 / 307
748amnon high in jersey cow compared to holstein dairy cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 308
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
687amnon high in chinese laoshan milk goat goat capra hircus compared to chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 318
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
756amnoncommon caecum, lethbridge, age 35 days, canada, broiler chicken, research facility, gallus gallus, chicken2021-03-22v4No1 / 321
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 325
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 325
61amnoncommon canis lupus familiaris, skin, research facility, united states of america, inguinal region2017-02-05v4No1 / 327
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 327
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland, fasting, every other day fasting2019-01-08v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
710amnon high in feces compared to small intestine stomach in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 329
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 337
649amnon high in ileum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 338
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 338
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
776amnoncommon caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 343
447amnoncommon mus musculus, mouse, caecum, c57bl/6, research facility, charles river laboratories, united states of america, state of maryland2019-01-08v4No1 / 343
187amnoncommon rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 351
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
916amnoncommon age 2 months, caecum, rabbit, oryctolagus cuniculus, research facility, kingdom of spain2022-07-04v4No1 / 361
876amnoncommon feces, age 20 months, juvenile organism, state of washington, united states of america, research facility, monkey, macaca mulatta2022-03-06v4No1 / 364
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, foot2018-03-30v4No1 / 368
225amnoncommon in wild type cotrols (common mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 370
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 379
108amnon high in caecum compared to colon in quail state of texas research facility united states of america coturnix coturnix 2017-04-07v4No1 / 380
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to a/j balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 380
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
739amnoncommon age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 392
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to clindamycin antibiotic in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 394
912amnon high in alive compared to dead in zebra mussel dreissena polymorpha fresh water aquarium mussel whole body body proper research facility 2022-05-27v4No1 / 398
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
905amnoncommon feces, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 401
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 402
808amnoncommon caecum, digesta, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 406
186amnoncommon rattus, rat, sprague dawley, research facility, caecum, united states of america2017-08-23v4No1 / 407
748amnon high in holstein dairy cow compared to jersey cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 407
905amnoncommon caecum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 417
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
687amnoncommon chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 429
929amnoncommon meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 432
808amnoncommon caecum, mucosa, germany, age 35 weeks, research facility, hen, chicken, gallus gallus2021-06-20v1No1 / 446
283amnoncommon pycnoscelus surinamensis, cockroach, burrowing cockroach, research facility, kingdom of denmark, hindgut, digestive system2018-01-25v4No1 / 448
905amnoncommon abomasum, age 1 year, western australia, research facility, australia, ovis aries, sheep2022-05-18v3No1 / 460
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
214amnon high in diet nih 31m chow mouse chow compared to high fat diet in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 495
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 504
910amnoncommon rumen, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 510
416amnoncommon termite, reticulitermes flaviceps, colon, research facility, united states of america2018-11-30v4No1 / 511
748amnoncommon jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 516
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
905amnoncommon colon, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 523
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
908amnoncommon guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 567
748amnoncommon holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 577
399amnoncommon feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 577
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, shell2018-03-30v4No1 / 579
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
808amnon high in ileum compared to caecum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 587
308amnoncommon red abalone, haliotis rufescens, united states of america, state of california, research facility, foot2018-03-30v4No1 / 592
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
905amnoncommon rumen, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 597
748amnon high in jersey cow compared to holstein dairy cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 603
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 609
748amnoncommon holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 614
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
748amnoncommon jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 632
308amnoncommon united states of america, state of california, research facility, haliotis sorenseni, white abalone, shell2018-03-30v4No1 / 632
748amnon high in holstein dairy cow compared to jersey cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 638
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 644
929amnon high in damara sheep compared to meatmaster sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 648
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
416amnon high in mulch diet compared to wood diet in termite reticulitermes flaviceps colon research facility united states of america 2018-11-30v4No1 / 681
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, tubeworm tube2019-02-13v4No1 / 683
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 698
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
808amnon high in mucosa compared to digesta in caecum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 701
929amnoncommon age 7 months, damara sheep, gauteng province, south africa, research facility, rumen, rumen liquid, sheep, ovis aries2022-08-16v3No1 / 706
671amnon high in 3-month-old human stage compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 714
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 727
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond water fresh water fishpond compared to fish ictalurus punctatus channel catfish intestine in united states of america state of alabama research facility )2019-02-12v4No1 / 741
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 754
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
632amnoncommon feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 848
632amnon high in feces compared to caecum cecal content in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 897
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
632amnoncommon caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 914
632amnon high in caecum cecal content compared to feces in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 943
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
687amnon high in chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus compared to chinese laoshan milk goat goat capra hircus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 1022
687amnoncommon chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1039
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 1065
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
687amnoncommon shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1147
916amnon high in farm2 compared to farm1 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1191
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v1No1 / 1194
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
808amnon high in ileal mucosa mucosa compared to digesta in ileum germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 1360
916amnon high in farm1 compared to farm2 in rabbit age 2 months kingdom of spain oryctolagus cuniculus caecum research facility 2022-07-04v4No1 / 1423
910amnon high in rumen compared to mouth mucosa oral cavity in age 140 days holstein dairy cow calve germany bos taurus juvenile stage research facility 2022-05-20v1No1 / 1744
808amnon high in caecum compared to ileum in digesta germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 1776
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
905amnon high in abomasum rumen compared to jejunum ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 2033
808amnon high in caecum compared to ileum in mucosa germany age 35 weeks research facility hen chicken gallus gallus 2021-06-20v1No1 / 2147
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
905amnon high in feces colon caecum compared to ileum jejunum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 2246
905amnon high in feces caecum colon compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2270
748amnon high in feces compared to ruminal fluid rumen in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2467
748amnon high in ruminal fluid rumen compared to feces in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2716
905amnon high in abomasum rumen compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org