Summary for ontology term: research facility

Number of annotations with term: 1043

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTCTTAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.002893
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCATGGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.002893
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Alcaligenaceae;g__AchromobacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGGAAAGAAAGATGTGAAATCCCAGAGCTTAACTTTGGAACTGCATTTTTAACTACCGAGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCG0.002893
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.001929
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.001929
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.001929
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.001929
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__RhizobiaceaeTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGAATTCCGAG0.001929
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGAGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGTGACTGCAAGGCTAGAGTACGGCAGAGGGGGGTGGAATTCCGCG0.001929
d__BacteriaTACAGGGGATGCAAGTGTTATCCGGAATTATTGGGCGTAAAGCGTCTGTAGGTTGATTTATAAGTCTTTTGTTAAATATTTAAGCTTAACTTAAAAAATGCAAAGGAAACTATTTATCTAGAGTTTGGTAGAGGTAAAGGGAATTTCCAG0.001929

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.375000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.375000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGAATGGAATTCCTGG0.375000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__BurkholderiaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTCCGCTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGGCGGGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG0.375000
TACGAGAGGGGTAAGCATTATTCATCATTAATGGGTCTAAAGGGTACGTAGGCTGTATCATAAGACTGGAAGGTATCGAACTAAATGAATAAGAGCTTTTCAGTAACTATGAAACTAGAGTGTAATGGAGGAAAGAGGAACTCCGAGAGT0.375000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__TerriglobusTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTTTGGCAAGTTTGGTGTGAAATCTTCGGGCTCAACTCGAAGTCTGCACCGAAAACTGCCGGGCTTGAGTATGGGAGAGGTGAGTGGAATTTCCGG0.375000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__RhodanobacterTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTAGTTAAGTCTGTCGTGAAATCCCCGGGCTCAACCTGGGAATGGCGATGGATACTGGCTGGCTAGAGTGTGTCAGAGGATGGTGGAATTTCCGG0.375000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Phyllobacteriaceae;g__AminobacterTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGTTAAGTTAGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGGCAATCTCGAGTCCGAGAGAGGTGAGTGGAATTCCGAG0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTATCGTGAAAGTCCGAGGCTCAACCTCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.375000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.272401
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.271783
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.265353
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.225188
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.220168
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.219653
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.219157
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGTTGACAAGTCAGATGTGAAATCCTGCGGCTTAACCGCAGAACTGCATTTGAAACTGTTGATCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.207483
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.205128
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGAGAGACAAGTCAGATGTGAAATCCACGGGCTCAACCCGTGAACTGCATTTGAAACTGTTTCCCTTGAGTGTCGGAGAGGTAATCGGAATTCCTTG0.204219

Annotations:

common ontology terms
term enrichment score
TermScore
research facility1.038688
mus musculus0.511147
mouse0.495595
united states of america0.339563
feces0.323745
c57bl/60.219882
caecum0.197632
male0.160305
china0.145338
female0.133024
rat0.126808
control0.122919
colon0.116991
chicken0.112667
gallus gallus0.112093
digestive system0.109521
LOWER IN control0.102547
rumen0.092254
rattus norvegicus0.089224
sheep0.085616
sprague dawley0.084087
ovis aries0.083822
australia0.083630
c57bl/6j0.083598
canada0.082254
female organism0.079888
fish0.078987
captive0.078960
macaca mulatta0.075949
state of texas0.074287
sweden0.074273
adult organism0.072267
intestine0.072172
ileum0.070123
high fat diet0.068306
age 6 weeks0.067937
canis lupus familiaris0.066593
monkey0.065058
jackson laboratories0.064935
bos taurus0.064529
mouse chow0.064177
sus scrofa0.062165
pig0.062165
germany0.060015
oncorhynchus mykiss0.059513
rainbow trout0.059513
diet0.056928
united kingdom0.052160
balb/c0.050046
adult0.050033
western australia0.048644
israel0.047585
dog0.047133
cecal content0.046275
age 8 weeks0.045336
age 1 year0.045336
digesta0.044240
rhesus macaque0.043996
state of california0.043557
holstein dairy cow0.041315
beagle dog0.040892
oryctolagus cuniculus0.040809
rattus0.039363
antibiotic0.039012
hen0.037629
rumen liquid0.037163
dentition0.036314
state of illinois0.035939
danio rerio0.035654
ruminal fluid0.035464
state of florida0.034592
charles river laboratories0.033739
LOWER IN antibiotic0.033364
new zealand0.033364
lamb0.033364
japan0.033207
male organism0.031079
skin0.030214
taconic farms0.030066
state of georgia0.029475
belgium0.029475
commonwealth of pennsylvania0.029331
age 35 weeks0.029331
oral cavity0.029117
cow0.028294
zebra fish0.028255
capra hircus0.028156
goat0.028156
larval stage0.027650
LOWER IN caecum0.027347
argentina0.026490
manchester0.026490
LOWER IN mouse chow0.026436
rabbit0.026374
swiss webster0.026316
age 35 days0.026316
state of oregon0.026144
province of alberta0.026144
state of mississippi0.026144
control diet0.026030
Fraction of dbbact annotations with this term covered by the query
TermScore
colon3.666667
LOWER IN colon2.000000
research facility1.088435
c57bl/61.055556
jackson laboratories1.000000
stress1.000000
LOWER IN stress1.000000
western australia1.000000
argentina1.000000
age 42 days1.000000
holstein dairy cow1.000000
age 140 days1.000000
coelomic fluid1.000000
hen1.000000
city of melbourne1.000000
neonate1.000000
LOWER IN neonate1.000000
raphanus sativus1.000000
composted animal manure1.000000
LOWER IN composted animal manure1.000000
constipation1.000000
LOWER IN constipation1.000000
adelaide1.000000
grape based wine or wine-like food product1.000000
LOWER IN age 18 weeks1.000000
manchester1.000000
age 18 weeks1.000000
lumen of colon1.000000
LOWER IN lumen of colon1.000000
fresh water aquarium1.000000
dreissena polymorpha1.000000
dead1.000000
LOWER IN alive1.000000
alive1.000000
LOWER IN dead1.000000
LOWER IN dreissena polymorpha1.000000
malaria1.000000
LOWER IN malaria1.000000
mouse0.947368
mus musculus0.920635
high fat diet0.916667
sprague dawley0.900000
LOWER IN mouse chow0.866667
LOWER IN high fat diet0.833333
danio rerio0.833333
ampicillin0.800000
zebra fish0.800000
c57bl/6j0.800000
age 6 weeks0.800000
rat0.777778
taconic farms0.750000
balb/c0.750000
fructose diet0.750000
fructose0.750000
LOWER IN fructose diet0.750000
LOWER IN fructose0.750000
rabbit0.750000
age 2 months0.750000
charles river laboratories0.750000
mouse chow0.733333
chicken0.687500
caecum0.666667
rex rabbit0.666667
macaca mulatta0.666667
age 9 weeks0.666667
low fat diet0.666667
LOWER IN low fat diet0.666667
beagle dog0.666667
cecal content0.666667
ovariectomy0.666667
LOWER IN fasting0.666667
oreochromis niloticus0.666667
juvenile0.666667
age 1 month0.666667
bombus terrestris0.666667
hymenolepis diminuta0.666667
LOWER IN hymenolepis diminuta0.666667
wistar rat0.666667
capra hircus0.666667
goat0.666667
humanized mouse0.666667
age 21 days0.666667
iron supplemented diet0.666667
LOWER IN iron deficient diet0.666667
iron deficient diet0.666667
LOWER IN iron supplemented diet0.666667
swiss webster0.666667
LOWER IN starch diet0.666667
starch diet0.666667
ictalurus punctatus0.666667
channel catfish0.666667
ruminal fluid0.666667
age 35 days0.666667
LOWER IN age 5 weeks0.666667
age 5 weeks0.666667
fishmeal diet0.666667
state of iowa0.666667
shanxi province0.666667
osteopilus septentrionalis0.666667
colonic mucosa0.666667
Fraction of annotations for the query sequences containing the term
TermScore
research facility0.993289
feces0.443912
united states of america0.442953
mus musculus0.353787
mouse0.335570
c57bl/60.122723
china0.121764
caecum0.116012
male0.093960
female0.085331
control0.080537
rat0.069032
digestive system0.065197
LOWER IN control0.064238
gallus gallus0.061361
chicken0.061361
colon0.059444
canada0.051774
australia0.051774
rumen0.050815
ovis aries0.047939
sheep0.047939
rattus norvegicus0.047939
captive0.046021
adult0.044104
sprague dawley0.044104
c57bl/6j0.044104
fish0.043145
sweden0.043145
female organism0.043145
state of texas0.041227
macaca mulatta0.040268
canis lupus familiaris0.040268
intestine0.039310
monkey0.038351
germany0.038351
adult organism0.038351
ileum0.037392
bos taurus0.037392
high fat diet0.035475
age 6 weeks0.035475
sus scrofa0.034516
pig0.034516
jackson laboratories0.033557
mouse chow0.033557
oncorhynchus mykiss0.031640
rainbow trout0.031640
diet0.030681
united kingdom0.030681
dog0.028763
state of california0.026846
balb/c0.025887
israel0.025887
age 8 weeks0.024928
age 1 year0.024928
western australia0.024928
cecal content0.023969
digesta0.023011
rhesus macaque0.023011
oryctolagus cuniculus0.021093
dentition0.021093
beagle dog0.021093
rattus0.021093
holstein dairy cow0.021093
antibiotic0.020134
rumen liquid0.019175
state of florida0.019175
hen0.019175
state of illinois0.019175
japan0.018217
danio rerio0.018217
ruminal fluid0.018217
LOWER IN antibiotic0.017258
skin0.017258
new zealand0.017258
lamb0.017258
charles river laboratories0.017258
male organism0.016299
taconic farms0.015340
state of georgia0.015340
commonwealth of pennsylvania0.015340
belgium0.015340
oral cavity0.015340
cow0.015340
age 35 weeks0.015340
LOWER IN caecum0.014382
zebra fish0.014382
larval stage0.014382
capra hircus0.014382
goat0.014382
subgingival plaque0.013423
control diet0.013423
state of oregon0.013423
LOWER IN mouse chow0.013423
argentina0.013423
rabbit0.013423
province of alberta0.013423
shandong province0.013423
swiss webster0.013423
pregnancy0.013423
Exp. ID User ID Description Date Region Flag Sequences
434amnon high in control diet compared to fructose diet fructose in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 1
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 1
108amnonquail mitochondria (other united states of america, research facility, colon, state of texas, quail, coturnix coturnix)2017-04-07v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in estradiol bisphenol a compared to control in research facility intestine danio rerio zebra fish china )2017-04-09v4No1 / 1
114amnondominant united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 1
114amnon high in control compared to contaminated water polychlorinated biphenyl 126 pcb in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in neutrophil hirschsprung disease high neutrophils compared to control low neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in control low neutrophils compared to neutrophil hirschsprung disease high neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
230amnondominant united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 1
244amnon high in diet cmy diet compared to starch diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
244amnon high in diet starch diet compared to cmy diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 1
351amnondominant bacteria in sea urchin gut (dominant digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin)2018-07-30v4No1 / 1
809amnondominant research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse)2019-01-10v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 2
604amnon high in bronchitis infectious bronchitis virus compared to control in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 2
114amnon high in contaminated water polychlorinated biphenyl 126 pcb compared to control in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 2
313amnon high in fishmeal diet compared to yeast diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-04-10v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 2
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in feces research facility mus musculus tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 3
313amnonlower in gut content of fish grown in 12C compared to 18C water ( high in warm temperature habitat 18c compared to 12c cold environment in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 3
313amnonlower in gut mucosa of fish grown in 12C compared to 18C water ( high in 18c warm termpterature habitat compared to 12c cold environment in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 3
315amnonlower in captive grown compared to wild frogs ( high in wild compared to research facility in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 3
809amnondominant research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 3
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in research facility stomach argentina liolaemus ruibali )2017-02-25v4No1 / 4
108amnondecreases during fasting in nile tilapia colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in diet american diet compared to bangladesh diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to body mass index high growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 4
908amnondominant feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 4
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 5
905amnondominant research facility, rumen, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 5
255amnondominant digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 5
313amnonhigh freq. in rainbow trout gut content grown in 18C water (dominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (dominant digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, warm temperature habitat, 18c)2018-04-10v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
431amnonhigh freq. in midgut of non-hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, no hibernation)2018-12-16v4No1 / 5
431amnonlower in midgut of hibernating bumble bees compared to non-hibernating ( high in non hibernating compared to hibernation in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 5
108amnondominant united states of america, research facility, colon, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 6
108amnondominant united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 6
112amnondominant research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 6
113amnondominant united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 6
649amnondominant research facility, jejunum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 6
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 6
263amnonhigh freq. in desert soil irrigated daily in lab (dominant research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 6
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (dominant digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 6
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
910amnondominant research facility, juvenile stage, rumen, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 6
632amnondominant united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 7
179amnondominant united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 7
217amnondominant feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 7
483amnondominant united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 7
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in research facility small intestine argentina liolaemus ruibali )2017-02-25v4No1 / 8
592amnondominant feces, united states of america, research facility, oryctolagus cuniculus, commonwealth of pennsylvania, rabbit2020-02-18v1No1 / 8
167amnondominant feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 8
181amnondominant digestive system, research facility, belgium, bombus terrestris, bumblebee2017-08-15v4No1 / 8
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese bohai black beef cattle2028-03-09v4No1 / 8
701amnondominant research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 8
230amnoncommon united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 8
255amnoncommon digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 8
262amnondominant research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 8
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 8
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, warm temperature habitat, 18c)2018-04-10v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 8
905amnondominant research facility, abomasum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 8
431amnoncommon in midgut of non-hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, no hibernation)2018-12-16v4No1 / 8
463amnondominant research facility, intestine, portunus trituberculatus, horse crab, china2019-01-13v4No1 / 8
483amnondominant united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 8
483amnondominant united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 8
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 9
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
649amnondominant research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 9
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese luxi yellow beef cattle2028-03-09v4No1 / 9
244amnondominant digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 9
741amnondominant research facility, intestine, china, planorbella trivolvis, ram's horn snail, pellet feed diet2021-02-17v3No1 / 9
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
308amnondominant feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 9
313amnoncommon in rainbow trout gut content grown in 18C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 9
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, defatted larvae insects diet2018-11-05v4No1 / 9
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 9
421amnonhigh freq. in paddy field soil incubated without copper (dominant research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 9
905amnondominant research facility, colon, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 9
905amnondominant research facility, ileum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 9
905amnondominant research facility, jejunum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 9
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 9
456amnondominant tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 9
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
69amnondominant united states of america, research facility, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 10
71amnondominant research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 10
700amnon high in caecum compared to colon in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 10
632amnondominant feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 10
113amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
117amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
649amnondominant research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 10
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in research facility rumen bos taurus rumen liquid shandong province china 2028-03-09v4No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
735amnondominant female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to age aging old age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
308amnondominant united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 10
321amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 10
808amnondominant research facility, caecum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 10
905amnondominant research facility, caecum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 10
905amnondominant feces, research facility, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 10
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 70 days2022-05-20v1No1 / 10
481amnondominant united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 10
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
264amnondominant research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 11
737amnondominant research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 11
787amnondominant control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 11
351amnoncommon digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 11
808amnondominant research facility, mucosa, caecum, gallus gallus, germany, chicken, age 35 weeks, hen2021-06-20v1No1 / 11
879amnondominant research facility, skin, canis lupus familiaris, austria, dog, captive, chest, adult organism2022-03-12v4No1 / 11
413amnondominant feces, research facility, mus musculus, c57bl/6j, mouse, mouse chow, jackson laboratory, ldlr -/-2018-11-26v4No1 / 11
446amnondominant united states of america, research facility, danio rerio, fish, zebrafish, larvae, age 15d2019-01-08v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 11
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 12
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
71amnondominant research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 12
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
123amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 12
657amnondominant research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 12
307amnondominant feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 12
308amnondominant feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
328amnondominant feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 12
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant united states of america, research facility, sea water, aquarium, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 12
817amnondominant united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 12
399amnondominant feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 12
879amnondominant research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 12
413amnondominant feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 12
903amnondominant research facility, poland, wine food product, grape based wine or wine-like food product, spontaneously fermented red wine2022-05-06v3No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
611amnon high in male compared to female in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 13
108amnon high in colon compared to caecum in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 13
649amnondominant research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 13
165amnonhigh freq. in house fly larva grown on moist wheat bran (dominant digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 13
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
187amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in diet bangladesh diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
748amnondominant feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 13
748amnondominant feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 13
308amnondominant united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 13
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
808amnondominant research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 13
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, larvae insect diet2018-11-05v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
866amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 13
421amnonhigh freq. in paddy field soil incubated with copper (dominant research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 13
903amnoncommon research facility, poland, wine food product, grape based wine or wine-like food product, spontaneously fermented red wine2022-05-06v3No1 / 13
441amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs high sugar diet age 18 weeks )2019-07-03v3No1 / 13
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus balb/c japan )2016-12-10v4No1 / 14
622amnondominant research facility, caecum, gallus gallus, chicken, great britain, liverpool, age 42 days2020-05-08v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 14
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 14
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
748amnondominant united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, jersey cow2021-03-10v4No1 / 14
308amnondominant united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 14
399amnondominant feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 14
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
876amnondominant feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 14
494amnondominant research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 14
25amnon high in compared to in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
69amnondominant united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 15
613amnondominant research facility, aquarium, gastrointestinal system, fish, poland, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 15
107amnondominant united states of america, research facility, colon, state of texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
687amnondominant research facility, rumen, rumen liquid, capra hircus, shandong province, china, goat, chinese laoshan milk goat2028-03-09v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 15
708amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in research facility intestine china planorbella trivolvis ram's horn snail 2021-02-17v3No1 / 15
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 15
308amnonhigh freq. in water of aquarium with red abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 15
308amnondominant united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 15
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 15
326amnondominant united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 15
328amnondominant research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 15
808amnondominant research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 15
358amnondominant feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 15
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre pupae insect diet2018-11-05v4No1 / 15
844amnondominant feces, research facility, mus musculus, c57bl/6, australia, mouse, iron deficient diet2021-11-17v3No1 / 15
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 15
860amnondominant research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 15
905amnondominant research facility, duodenum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 15
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 15
910amnondominant research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, age 42 days, holstein dairy cow2022-05-20v1No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
456amnoncommon tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
457amnondominant feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 15
494amnondominant research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in feces research facility caecum rattus norvegicus sprague dawley switzerland rat 2018-12-20v4No1 / 16
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
108amnondominant united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
748amnondominant united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 16
324amnondominant digestive system, research facility, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
416amnondominant united states of america, research facility, colon, termite, reticulitermes flaviceps2018-11-30v4No1 / 16
893amnondominant united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, silty clay loam2022-04-11v4No1 / 16
904amnondominant research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 16
471amnondominant digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 16
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
71amnondominant feces, research facility, argentina, liolaemus ruibali2017-02-25v4No1 / 17
611amnondominant research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 17
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 17
116amnondominant research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 17
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
688amnondominant feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 17
212amnondominant feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
283amnondominant digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 17
776amnondominant research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 17
351amnondominant united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
369amnondominant feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 17
897amnondominant research facility, caecum, gallus gallus, male, australia, chicken, age 4 weeks, broiler chicken, adelaide2022-04-18v3No1 / 17
897amnondominant research facility, caecum, gallus gallus, male, australia, chicken, age 4 weeks, adelaide, layer chicken, isa brown2022-04-18v3No1 / 17
912amnondominant research facility, body proper, whole body, mussel, fresh water aquarium, dreissena polymorpha, zebra mussel2022-05-27v4No1 / 17
481amnondominant united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 17
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 18
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 18
119amnondominant feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 18
649amnon high in duodenum jejunum compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
214amnondominant feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
739amnondominant research facility, rumen, age 5 years, ruminal fluid, capra hircus, argentina, goat, creole goat2021-01-30v4No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 18
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 18
780amnondominant research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 18
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
351amnondominant feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 18
817amnondominant united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
419amnondominant feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 18
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 19
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
216amnondominant feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 19
324amnonhiger in crickets fed chemically defined diet compared to cat chow diet ( high in diet chemically defined diet compared to cat chow in digestive system research facility midgut colon australia gryllinae field cricket )2018-04-27v4No1 / 19
795amnoncommon research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 19
844amnondominant feces, research facility, mus musculus, c57bl/6, australia, mouse, iron supplemented diet2021-11-17v3No1 / 19
866amnondominant feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 19
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 19
431amnonhigh freq. in midgut of hibernating bumble bees (dominant research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 19
463amnoncommon research facility, intestine, portunus trituberculatus, horse crab, china2019-01-13v4No1 / 19
503amnondominant feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 19
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 19
46amnonsmj: higher in mice feces with antiobiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 20
434amnondominant feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 20
69amnondominant united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 20
614amnonincreases in picher plant fluid grown in lab ( high in research facility late time points days 57-60 compared to early time points wild days 0-3 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 20
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
697amnondominant female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 20
188amnondominant feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 20
262amnonlower in tick larvae fed on PIXR immunized mice compared to non immunized ( high in control compared to pixr immunized in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 20
322amnondominant digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in intestine mucosa digestive tract compared to feces in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
368amnondominant feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 20
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 20
879amnondominant feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 20
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 20
437amnondominant united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 20
457amnondominant feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 20
476amnondominant feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 21
69amnondominant united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 21
108amnondominant united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 21
108amnondominant united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
221amnondominant feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 21
741amnondominant research facility, intestine, china, planorbella trivolvis, ram's horn snail, alfalfa diet2021-02-17v3No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 21
853amnondominant research facility, oryctolagus cuniculus, french republic, cecal content, rabbit, caecum, juvenile, age 5 weeks, hyplus rabbit, soild food supplemented diet, solid food diet2021-12-20v3No1 / 21
879amnondominant feces, research facility, canis lupus familiaris, austria, dog, captive, adult organism2022-03-12v4No1 / 21
893amnondominant united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, sandy loam2022-04-11v4No1 / 21
429amnondominant feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 21
442amnondominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 21
483amnondominant united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 21
503amnondominant feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 21
522amnondominant feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 21
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 22
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 22
248amnondominant feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 22
334amnondominant feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 22
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 23
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
71amnondominant research facility, hindgut, colon, argentina, liolaemus ruibali2017-02-25v4No1 / 23
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to age late timepoints age 35 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 23
392amnon high in fishmeal diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 23
853amnon high in age 3 weeks compared to age 5 weeks in research facility caecum oryctolagus cuniculus french republic cecal content rabbit juvenile hyplus rabbit exclusive breastmilk diet 2021-12-18v3No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in vaccination immunization heat killed mycobacterium vaccae compared to vehicle bbs in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
756amnondominant research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 24
322amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 24
349amnondominant feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 24
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 24
392amnon high in fishmeal diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 24
853amnondominant research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, age 3 weeks, juvenile, hyplus rabbit, exclusive breastmilk diet2021-12-18v3No1 / 24
853amnondominant research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 24
471amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 24
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
108amnondominant united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 25
181amnoncommon digestive system, research facility, belgium, bombus terrestris, bumblebee2017-08-15v4No1 / 25
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
909amnondominant feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 26
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
114amnondominant united states of america, research facility, intestine, tadpole, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 26
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
826amnondominant united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 26
909amnondominant feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 27
584amnon high in type i diabetes mellitus induced type 1 diabetes compared to control in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 27
586amnondominant feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 27
838amnondominant united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 27
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 28
267amnoncommon digestive system, research facility, oreochromis niloticus, fish, china2017-12-24v4No1 / 28
741amnoncommon research facility, intestine, china, planorbella trivolvis, ram's horn snail, pellet feed diet2021-02-17v3No1 / 28
817amnoncommon united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet western diet very high sugar diet compared to high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 28
622amnon high in ileum compared to caecum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 29
668amnondominant feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 29
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 29
817amnon high in lung bronchoalveolar lavage compared to saliva oral cavity oral wash cheek pouch in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 29
822amnondominant feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 29
885amnondominant feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in feces research facility mus musculus balb/c mouse japan )2019-03-12v4No1 / 29
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
876amnoncommon feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 30
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 30
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 31
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 31
262amnoncommon research facility, larval stage, body proper, ixodes scapularis, tick2017-12-10v4No1 / 31
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 31
446amnoncommon united states of america, research facility, danio rerio, fish, zebrafish, larvae, age 15d2019-01-08v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
392amnon high in larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 32
885amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 32
905amnon high in jejunum compared to ileum in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
71amnoncommon research facility, small intestine, argentina, liolaemus ruibali2017-02-25v4No1 / 33
611amnon high in female compared to male in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 33
108amnonincreases during fasting in quail caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum state of texas quail coturnix coturnix )2017-04-07v4No1 / 33
668amnon high in age 4 months compared to age 5 years in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 33
187amnonpositively correlated with age 25-35 weeks ( high in age late time points 35 weeks compared to early time points 25 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 33
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in research facility rumen bos taurus rumen liquid shandong province china 2028-03-09v4No1 / 34
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 34
866amnon high in iga positive fraction compared to iga negative fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 34
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
262amnonhigher in tick larvae fed on PIXR immunized mice compared to non immunized ( high in pixr immunized compared to control in research facility larval stage body proper ixodes scapularis tick )2017-12-10v4No1 / 35
897amnon high in broiler chicken compared to layer chicken isa brown in research facility caecum gallus gallus male australia chicken age 4 weeks adelaide 2022-04-18v3No1 / 35
909amnon high in feces compared to lumen of colon in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 36
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in feces united states of america research facility mus musculus mouse cba/j mice )2017-08-24v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 37
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in feces research facility rattus norvegicus sprague dawley rat male 2020-01-31v3No1 / 38
649amnoncommon research facility, jejunum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 38
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 38
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
909amnon high in age 6 weeks compared to age 18 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 39
113amnoncommon united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
687amnon high in high milk yield compared to low milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 40
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
112amnoncommon research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 41
614amnondecreases in picher plant fluid grown in lab ( high in early time points wild days 0-3 compared to research facility late time points days 57-60 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 42
108amnoncommon united states of america, research facility, colon, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 43
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
866amnon high in stress restraint stress compared to control in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 44
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 44
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 45
108amnonincreases during fasting in southern frog colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon state of texas anaxyrus terrestris southern toad )2017-04-07v4No1 / 45
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
649amnoncommon research facility, duodenum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 45
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in feces research facility austria captive adult organism 2022-03-12v4No1 / 45
912amnon high in body proper whole body mussel dreissena polymorpha zebra mussel compared to fresh water aquarium water in united states of america research facility state of minnesota fresh water aquarium 2022-05-27v4No1 / 45
392amnon high in larvae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
211amnon high in male compared to female in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in iron deficient diet low iron compared to iron iron supplemented diet in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 47
744amnon high in ileum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 47
853amnon high in exclusive breastmilk diet compared to soild food supplemented diet solid food diet in research facility caecum oryctolagus cuniculus french republic cecal content rabbit juvenile age 5 weeks hyplus rabbit 2021-12-20v3No1 / 47
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in feces research facility rattus norvegicus dahl salt-sensitive israel rat )2018-12-13v4No1 / 47
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 49
853amnon high in age 5 weeks compared to age 3 weeks in research facility caecum oryctolagus cuniculus french republic cecal content rabbit juvenile hyplus rabbit exclusive breastmilk diet 2021-12-18v3No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 51
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 51
324amnonlower in crickets fed chemically defined diet compared to cat chow diet ( high in diet cat chow compared to chemically defined diet in digestive system research facility midgut colon australia gryllinae field cricket )2018-04-27v4No1 / 51
392amnon high in larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 51
413amnon high in high fat diet compared to mouse chow in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 51
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 52
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
897amnon high in layer chicken isa brown compared to broiler chicken in research facility caecum gallus gallus male australia chicken age 4 weeks adelaide 2022-04-18v3No1 / 52
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 53
909amnon high in lumen of colon compared to feces in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 53
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
649amnoncommon research facility, ileum, ovis aries, new zealand, sheep, lamb, age 6 weeks2020-09-07v3No1 / 55
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, larvae insect diet2018-11-05v4No1 / 55
817amnon high in saliva oral cavity oral wash cheek pouch compared to lung bronchoalveolar lavage in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
431amnoncommon in midgut of hibernating bumble bees (common research facility, midgut, belgium, bombus terrestris, bumble bee, queen, hibernation)2018-12-16v4No1 / 57
116amnoncommon research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 58
808amnoncommon research facility, mucosa, ileum, gallus gallus, germany, chicken, age 35 weeks, ileal mucosa, hen2021-06-20v1No1 / 58
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 58
392amnon high in defatted larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in feces research facility mus musculus c57bl/6 mouse japan )2019-03-12v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
416amnon high in wood diet compared to fasting in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 59
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 60
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron deficient diet2021-11-17v3No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to high fat diet western diet very high sugar diet in feces female research facility mus musculus c57bl/6j germany mouse janvier labs age 18 weeks )2019-07-03v3No1 / 60
586amnon high in control diet compared to fructose diet fructose in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
905amnon high in ileum compared to jejunum in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 61
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 62
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
657amnonpostively correlated with age ( high in age older age compared to younger age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 65
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 65
326amnon high in diet high fat diet compared to mouse chow in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 65
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 66
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
71amnon high in stomach small intestine compared to feces hindgut colon in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 67
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in feces research facility austria captive adult organism 2022-03-12v4No1 / 67
211amnonCommon in multiple mouse strains feces (common feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 70
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 70
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
896amnon high in starch diet compared to glucose diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 70
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in diet whole grain diet compared to normal diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 71
853amnon high in soild food supplemented diet solid food diet compared to exclusive breastmilk diet in research facility oryctolagus cuniculus french republic cecal content rabbit caecum juvenile age 5 weeks hyplus rabbit 2021-12-20v3No1 / 71
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
808amnoncommon research facility, ileum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common feces, research facility, mediterranean sea, italy, adriatic sea coastal waters of italy, caretta caretta, loggerhead sea turtle)2021-06-22v3No1 / 72
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in feces research facility mus musculus c57bl/6 australia mouse 2021-11-17v3No1 / 72
879amnoncommon feces, research facility, canis lupus familiaris, austria, dog, captive, adult organism2022-03-12v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 73
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
879amnoncommon feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 73
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum state of texas quail coturnix coturnix )2017-04-07v4No1 / 76
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
866amnon high in iga negative fraction compared to iga positive fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 76
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
431amnonhigher in midgut of hibernating bumble bees compared to non-hibernating ( high in hibernation compared to non hibernating in research facility midgut belgium bombus terrestris bumble bee queen )2018-12-16v4No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
905amnon high in abomasum compared to rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 78
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
324amnoncommon digestive system, research facility, midgut, colon, australia, gryllinae, field cricket2018-04-27v4No1 / 79
822amnon high in high fiber compared to hydrolized diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 79
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
483amnoncommon united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to mouse chow age 6 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 81
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 82
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 82
853amnoncommon research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, age 3 weeks, juvenile, hyplus rabbit, exclusive breastmilk diet2021-12-18v3No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in control normal diet compared to diet whole wheat diet in feces research facility mus musculus obesity )2016-12-09v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
816amnon high in early pregnancy compared to late pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 83
114amnoncommon united states of america, research facility, intestine, tadpole, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
668amnoncommon feces, research facility, felis catus, new zealand, cat2020-09-26v3No1 / 85
844amnoncommon feces, research facility, mus musculus, c57bl/6, australia, mouse, iron supplemented diet2021-11-17v3No1 / 85
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
108amnon high in caecum compared to colon in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
71amnoncommon research facility, stomach, argentina, liolaemus ruibali2017-02-25v4No1 / 88
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
822amnon high in hydrolized diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 88
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus )2022-04-11v4No1 / 88
214amnoncommon feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 89
399amnoncommon feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 89
904amnoncommon research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 89
114amnon high in tadpole compared to adult in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 90
503amnon high in balb/c compared to c57bl/6 in feces research facility mus musculus mouse japan 2019-03-12v4No1 / 91
649amnon high in ileum compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 92
668amnon high in age 5 years compared to age 4 months in feces research facility felis catus new zealand cat 2020-09-26v3No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 92
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 94
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to intestine mucosa digestive tract in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 94
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
214amnoncommon feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 95
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 95
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 96
853amnoncommon research facility, caecum, oryctolagus cuniculus, french republic, cecal content, rabbit, juvenile, age 5 weeks, hyplus rabbit, exclusive breastmilk diet2021-12-20v3No1 / 96
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 97
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
441amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
912amnon high in dead compared to alive in research facility body proper whole body mussel fresh water aquarium dreissena polymorpha zebra mussel 2022-05-27v4No1 / 100
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 101
413amnoncommon feces, research facility, mus musculus, c57bl/6j, high fat diet, mouse, jackson laboratory, ldlr -/-2018-11-26v4No1 / 101
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 102
108amnon high in colon compared to caecum in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 103
822amnon high in high protein diet meat diet compared to hydrolized diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 103
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 106
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
776amnon high in wild age 15-20 weeks feral compared to research facility captive broiler chicken age 5 weeks in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 107
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 108
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in feces research facility mus musculus c57bl/6 japan )2016-12-10v4No1 / 108
328amnoncommon research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 109
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 110
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
912amnoncommon research facility, body proper, whole body, mussel, fresh water aquarium, dreissena polymorpha, zebra mussel2022-05-27v4No1 / 112
71amnoncommon feces, research facility, argentina, liolaemus ruibali2017-02-25v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
217amnoncommon feces, female, research facility, mus musculus, c57bl/6, mouse2017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
853amnoncommon research facility, oryctolagus cuniculus, french republic, cecal content, rabbit, caecum, juvenile, age 5 weeks, hyplus rabbit, soild food supplemented diet, solid food diet2021-12-20v3No1 / 114
905amnoncommon research facility, jejunum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 114
416amnon high in wood diet compared to mulch diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 115
613amnoncommon research facility, aquarium, gastrointestinal system, poland, fish, olsztyn, esox lucius, pike fry, gut2020-04-25v3No1 / 116
328amnoncommon feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 116
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
822amnon high in high fiber compared to high protein diet meat diet in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 118
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in intestine ictalurus punctatus fish channel catfish compared to pond water fresh water in united states of america research facility state of alabama )2019-02-12v4No1 / 118
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
113amnon high in adult compared to larval stage in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 120
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 120
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 120
537amnoncommon in feces of captive grown deer mice feces (common feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
326amnoncommon united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 122
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus )2022-04-11v4No1 / 122
741amnon high in alfalfa diet compared to pellet feed diet in research facility intestine china planorbella trivolvis ram's horn snail 2021-02-17v3No1 / 123
822amnon high in high protein diet meat diet compared to high fiber in feces research facility canis lupus familiaris australia city of melbourne dog foxhound 2021-08-29v4No1 / 123
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
392amnon high in pre pupae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, janvier labs, high sugar diet, age 18 weeks2019-07-03v3No1 / 126
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
649amnoncommon research facility, ovis aries, new zealand, sheep, lamb, age 6 weeks, colon2020-09-07v3No1 / 128
458amnoncommon in mice strains from jackson laboratories (common feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 129
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
586amnon high in fructose diet fructose compared to control diet in feces research facility rattus norvegicus sprague dawley israel rat male 2020-02-09v4No1 / 130
522amnoncommon feces, female, research facility, mus musculus, c57bl/6j, germany, mouse, mouse chow, age 6 weeks, janvier labs2019-07-03v3No1 / 130
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
39amnoncommon in obese lepr-db mice (common feces, research facility, mus musculus, obesity)2016-12-09v4No1 / 132
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 134
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in fertilized water irrigation treated wastewater irrigation tapwater irrigation compared to artificial wastewater irrigation in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 134
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
897amnoncommon research facility, caecum, gallus gallus, male, australia, chicken, age 4 weeks, broiler chicken, adelaide2022-04-18v3No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
905amnoncommon research facility, ileum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 137
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 139
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 140
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
893amnoncommon united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, silty clay loam2022-04-11v4No1 / 140
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
741amnoncommon research facility, intestine, china, planorbella trivolvis, ram's horn snail, alfalfa diet2021-02-17v3No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 141
893amnoncommon united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, sandy loam2022-04-11v4No1 / 142
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
71amnoncommon research facility, hindgut, colon, argentina, liolaemus ruibali2017-02-25v4No1 / 144
897amnoncommon research facility, caecum, gallus gallus, male, australia, chicken, age 4 weeks, adelaide, layer chicken, isa brown2022-04-18v3No1 / 144
611amnoncommon research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 145
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 145
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, foxhound, hydrolized diet2021-08-29v4No1 / 145
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 147
471amnoncommon digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
307amnoncommon feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 148
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 150
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, dog, high protein diet, foxhound, meat diet2021-08-29v4No1 / 151
481amnoncommon united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 151
866amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 152
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 153
822amnoncommon feces, research facility, canis lupus familiaris, australia, city of melbourne, high fiber, dog, foxhound2021-08-29v4No1 / 153
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 154
912amnon high in fresh water aquarium water compared to body proper whole body mussel dreissena polymorpha zebra mussel in united states of america research facility state of minnesota fresh water aquarium 2022-05-27v4No1 / 154
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 155
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
322amnoncommon digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 161
368amnoncommon feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 161
909amnoncommon feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
413amnon high in mouse chow compared to high fat diet in feces research facility mus musculus c57bl/6j mouse jackson laboratory ldlr -/- 2018-11-26v4No1 / 163
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
456amnoncommon united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 167
909amnoncommon feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
457amnoncommon feces, research facility, mus musculus, male, finland, mouse, c57bl/6ncrl, high fat diet + polydextrose, polydextrose2019-01-11v4No1 / 168
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
885amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 170
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 179
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
107amnoncommon united states of america, research facility, colon, state of texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
321amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 184
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
188amnoncommon feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 185
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 186
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in feces research facility mus musculus male finland mouse c57bl/6ncrl )2019-01-11v4No1 / 186
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
885amnoncommon feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 188
326amnon high in diet mouse chow compared to high fat diet in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 189
860amnoncommon research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 190
413amnoncommon feces, research facility, mus musculus, c57bl/6j, mouse, mouse chow, jackson laboratory, ldlr -/-2018-11-26v4No1 / 190
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 70 days2022-05-20v1No1 / 191
808amnon high in digesta compared to mucosa ileal mucosa in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 192
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 193
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 195
592amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, commonwealth of pennsylvania, rabbit2020-02-18v1No1 / 196
866amnon high in control compared to stress restraint stress in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 196
372amnon high in high fat diet compared to mouse chow in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 199
334amnoncommon feces, research facility, mus musculus, c57bl/6, israel, mouse2018-05-15v4No1 / 200
905amnoncommon research facility, duodenum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 200
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, age 42 days, holstein dairy cow2022-05-20v1No1 / 202
248amnoncommon feces, research facility, mus musculus, germany, mouse, fvb/n mice2017-11-22v4No1 / 203
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
457amnoncommon feces, research facility, mus musculus, high fat diet, male, finland, mouse, c57bl/6ncrl2019-01-11v4No1 / 204
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 207
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
123amnon high in diet normal diet regular mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 209
481amnoncommon united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 210
503amnoncommon feces, research facility, mus musculus, c57bl/6, mouse, japan2019-03-12v4No1 / 210
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 211
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 212
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 215
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
808amnon high in ileum compared to caecum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 224
369amnoncommon feces, research facility, mus musculus, c57bl/6j, switzerland, mouse, mouse chow2018-09-06v4No1 / 224
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 225
42amnoncommon in tcr-b deficient balb/c mice (common feces, research facility, mus musculus, balb/c, japan)2016-12-10v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
708amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
826amnoncommon united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 233
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
434amnoncommon feces, research facility, caecum, rattus norvegicus, sprague dawley, switzerland, rat2018-12-20v4No1 / 238
896amnon high in glucose diet compared to starch diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 238
119amnoncommon feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 239
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
308amnoncommon in water of aquarium with red abalone (common united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 240
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, control diet, male2020-02-09v4No1 / 241
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
622amnoncommon research facility, caecum, gallus gallus, chicken, great britain, liverpool, age 42 days2020-05-08v4No1 / 244
910amnoncommon research facility, juvenile stage, oral cavity, mouth mucosa, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 245
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, salt, salt rich diet2018-12-13v4No1 / 249
219amnoncommon in mother mice feces (common feces, female, research facility, mus musculus, c57bl/6, mouse, south korea)2017-10-24v4No1 / 250
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
776amnon high in research facility captive broiler chicken age 5 weeks compared to wild age 15-20 weeks feral in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 252
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
71amnon high in feces hindgut colon compared to stomach small intestine in research facility argentina liolaemus ruibali 2017-02-25v4No1 / 255
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 255
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon feces, research facility, mus musculus, balb/c, mouse, japan2019-03-12v4No1 / 257
308amnoncommon feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 258
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
905amnon high in rumen compared to abomasum in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 264
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 265
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
808amnon high in digesta compared to mucosa in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 266
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
494amnoncommon research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 275
910amnon high in age 70 days compared to age 140 days in research facility juvenile stage oral cavity mouth mucosa bos taurus germany calve holstein dairy cow 2022-05-20v1No1 / 276
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in feces research facility mus musculus israel mouse )2018-05-15v4No1 / 284
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
586amnoncommon feces, research facility, rattus norvegicus, sprague dawley, israel, rat, fructose diet, fructose, male2020-02-09v4No1 / 287
494amnon high in mouse chow compared to diet high fat diet western diet in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 293
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
649amnon high in duodenum jejunum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron iron supplemented diet compared to iron deficient diet low iron in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 295
737amnoncommon research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 295
476amnoncommon feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 297
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 299
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
910amnon high in age 140 days compared to age 70 days in research facility juvenile stage oral cavity mouth mucosa bos taurus germany calve holstein dairy cow 2022-05-20v1No1 / 302
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
622amnon high in caecum compared to ileum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 307
748amnon high in jersey cow compared to holstein dairy cow in feces united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 308
358amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2018-08-19v4No1 / 309
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
687amnon high in capra hircus goat chinese laoshan milk goat compared to bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 318
322amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 320
879amnoncommon research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 320
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321
123amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 325
522amnon high in mouse chow age 6 weeks compared to high sugar diet age 18 weeks in feces female research facility mus musculus c57bl/6j germany mouse janvier labs 2019-07-03v3No1 / 325
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
429amnoncommon feces, research facility, rattus norvegicus, dahl salt-sensitive, israel, rat, control diet2018-12-13v4No1 / 327
447amnoncommon united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 328
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
649amnon high in ileum compared to colon in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 338
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 338
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
447amnoncommon united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 343
187amnoncommon feces, research facility, rattus, czech republic, rat, wistar rat2017-08-23v4No1 / 351
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
687amnon high in low milk yield compared to high milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 375
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 379
108amnon high in caecum compared to colon in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 380
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to balb/c a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 380
216amnoncommon feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 385
739amnoncommon research facility, rumen, age 5 years, ruminal fluid, capra hircus, argentina, goat, creole goat2021-01-30v4No1 / 392
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 394
912amnon high in alive compared to dead in research facility body proper whole body mussel fresh water aquarium dreissena polymorpha zebra mussel 2022-05-27v4No1 / 398
879amnoncommon research facility, skin, canis lupus familiaris, austria, dog, captive, chest, adult organism2022-03-12v4No1 / 399
905amnoncommon feces, research facility, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 401
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 402
808amnoncommon research facility, caecum, gallus gallus, germany, digesta, chicken, age 35 weeks, hen2021-06-20v1No1 / 406
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
748amnon high in holstein dairy cow compared to jersey cow in feces united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 407
905amnoncommon research facility, caecum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 417
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
687amnoncommon research facility, rumen, rumen liquid, capra hircus, shandong province, china, goat, chinese laoshan milk goat2028-03-09v4No1 / 429
808amnoncommon research facility, mucosa, caecum, gallus gallus, germany, chicken, age 35 weeks, hen2021-06-20v1No1 / 446
283amnoncommon digestive system, research facility, hindgut, kingdom of denmark, pycnoscelus surinamensis, cockroach, burrowing cockroach2018-01-25v4No1 / 448
905amnoncommon research facility, abomasum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 460
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 504
910amnoncommon research facility, juvenile stage, rumen, bos taurus, germany, calve, holstein dairy cow, age 140 days2022-05-20v1No1 / 510
416amnoncommon united states of america, research facility, colon, termite, reticulitermes flaviceps2018-11-30v4No1 / 511
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
905amnoncommon research facility, colon, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 523
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
905amnon high in jejunum ileum compared to abomasum rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 563
908amnoncommon feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 567
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 577
399amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 577
308amnoncommon united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 579
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
893amnon high in sandy loam compared to silty clay loam in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus 2022-04-11v4No1 / 582
808amnon high in ileum compared to caecum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 587
308amnoncommon united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 592
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 593
905amnoncommon research facility, rumen, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 597
748amnon high in jersey cow compared to holstein dairy cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 603
893amnon high in silty clay loam compared to sandy loam in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus 2022-04-11v4No1 / 605
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 609
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 614
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, jersey cow2021-03-10v4No1 / 632
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
25amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, sichuan province2016-12-01v4No1 / 669
416amnon high in mulch diet compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 681
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 683
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
808amnon high in mucosa compared to digesta in research facility caecum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 701
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond fishpond water fresh water compared to intestine ictalurus punctatus fish channel catfish in united states of america research facility state of alabama )2019-02-12v4No1 / 741
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
632amnon high in feces compared to caecum cecal content in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 897
649amnon high in colon compared to ileum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 897
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
632amnon high in caecum cecal content compared to feces in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 943
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
687amnon high in bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle compared to capra hircus goat chinese laoshan milk goat in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 1022
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese luxi yellow beef cattle2028-03-09v4No1 / 1039
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065
263amnoncommon in desert soil irrigated daily in lab (common research facility, soil, israel, negev desert, sandy loam soil, ph 7-8, irrigated)2017-12-11v4No1 / 1076
905amnon high in jejunum ileum compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 1092
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese bohai black beef cattle2028-03-09v4No1 / 1147
910amnon high in oral cavity mouth mucosa compared to rumen in research facility juvenile stage bos taurus germany calve holstein dairy cow age 140 days 2022-05-20v1No1 / 1194
649amnon high in colon compared to duodenum jejunum in research facility ovis aries new zealand sheep lamb age 6 weeks 2020-09-07v3No1 / 1261
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
808amnon high in mucosa ileal mucosa compared to digesta in research facility ileum gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 1360
910amnon high in rumen compared to oral cavity mouth mucosa in research facility juvenile stage bos taurus germany calve holstein dairy cow age 140 days 2022-05-20v1No1 / 1744
808amnon high in caecum compared to ileum in research facility gallus gallus germany digesta chicken age 35 weeks hen 2021-06-20v1No1 / 1776
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in research facility soil israel negev desert sandy loam soil ph 7-8 irrigated )2017-12-11v4No1 / 1893
905amnon high in abomasum rumen compared to jejunum ileum in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 2033
808amnon high in caecum compared to ileum in research facility mucosa gallus gallus germany chicken age 35 weeks hen 2021-06-20v1No1 / 2147
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
905amnon high in feces caecum colon compared to jejunum ileum in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 2246
905amnon high in feces caecum colon compared to abomasum rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 2270
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716
905amnon high in abomasum rumen compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org