Summary for ontology term: rhesus macaque

Number of annotations with term: 24

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAAACTGGCGGCTCAACCGTCAGCCTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.523810
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATGCTAAGGCTTAACCATAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.520000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACCTTTAAGTCAGCTGTGAAATACGGCGGCTCAACCGTCGAACTGCAGTTGATACTGGAGGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.478261
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCTGATTAAGCGTGTTGTGAAATGTAGAGGCCCAACCTCTGCACTGCAGCGCGAACTGGTTAGCTTGAGTGTGCACAATGTAGGCGGAATTTGTGG0.473684
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATTGCAAGCCAGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTAAAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.450000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGTGCGCAGGCGGGATAGCAAGTCAGATGTGAAATGCTATGGCTTAACCATAGAACTGCATTTGAAACTGCTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.431373
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGACCCTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCACCGCAGCGCGAACTGGGGGTCTTGAGTTCACGGGAGGAAGGCGGAATTCGTGG0.428571
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGCAGGCTAAGCGTGTCGTGAAATCCAGTCGCTCAACGGCTGGCGTGCGGCGCGAACTGGCCTGCTTGAGTACGCGGGACGTTGGCGGAATTCGTGG0.411765
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGAGGTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACCGCAGCGCGAACTGCCCCACTTGAGTGCGCGCAACGCCGGCGGAACTCGTCG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCCTTTAAGCGTGTTGTGAAATACTGCCGCTCAACGGCAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAAGGCAGGCGGAATTCGTCG0.400000

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
age 1 month0.333333
LOWER IN age 1 month0.333333
macaca mulatta0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
3-month-old human stage0.142857
LOWER IN 3-month-old human stage0.142857
monkey0.071429
captive0.055556
state of california0.038462
LOWER IN state of california0.038462
female0.015873
LOWER IN female0.015873
research facility0.006803
adult0.005780
LOWER IN adult0.005780
united states of america0.004049
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
macaca mulatta1.000000
monkey1.000000
captive1.000000
rhesus macaque1.000000
3-month-old human stage0.250000
age 8 months0.250000
age 1 month0.208333
female0.208333
adult0.208333
state of california0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
LOWER IN state of california0.166667
age 6 months0.125000
LOWER IN age 8 months0.083333
LOWER IN 3-month-old human stage0.083333
LOWER IN age 6 months0.041667
LOWER IN female0.041667
LOWER IN adult0.041667
LOWER IN age 1 month0.041667
Exp. ID User ID Description Date Region Flag Sequences
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955

Problems / suggestions? Please email info AT dbbact DOT org