Summary for ontology term: rhizosphere

Number of annotations with term: 347

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.030769
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAACTGGAGGCTCAACCTCCAGCCTGCAGTGGGTACGGGCAAACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.030769
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__DyadobacterTACGGAGGGTGCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTGTTTAAGTCAGTGGTGAAATACGGTTGCTCAACAATCGAGGTGCCATTGATACTGAATAGCTTGAAATAATTGGAGGCTGCCGGAATGGATGG0.030769
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGGGCTCAACCCCGGAACTGCCTTTAAGACTGCATCGCTTGAATCCGGGAGAGGTGAGTGGAATTCCGAG0.030769
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__MassiliaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCTGTCGTGAAATCCCCGGGCTCAACCTGGGAATTGCGATGGAGACTGCAAGGCTAGAATCTGGCAGAGGGGGGTAGAATTCCACG0.027692
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGGGCTCAACTCCGGAATTGCCTTTAAGACTGCATCGCTAGAATTGTGGAGAGGTAAGTGGAATTCCGAG0.027692
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 1TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGAAAAGCGGAATTCCACG0.027692
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.027692
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Solirubrobacteraceae;g__SolirubrobacterTACGTAGGGGGCTAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGTCCGGTAAGTCCGCTGTGAAAGTCGGGGGCTCAACCCTCGGATGCCGGTGGATACTGTCGGGCTTGAGTACGGAAGAGGCGAGTGGAATTCCTGG0.027692
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__LysobacterTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTCGTTAAGTCTGATGTGAAAGCCCTGGGCTCAACCTGGGAATGGCATTGGATACTGGCGACCTAGAGTGCGGTAGAGGGGTGTGGAATTCCCGG0.027692

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.208333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTGATGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCATCGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.208333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCTGCTGTGAAAACTCGGGGCTTAACCCCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGACTGGAATTCCTGG0.208333
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACGAAGGGTGCAAACGTTGCTCGGAATTATTGGGCGTAAAGCGCACGTAGGCGGCTTTGCAAGTCGGATGTGAAATCCCTCGGCTTAACCAAGGAAGTGCATCCGAAACTGCAGAGCTTGAGTACTTAAGAGGATCGCGGAATTCCCGG0.208333
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Rhodospirillaceae;g__SkermanellaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTGTGTCAAGTCAGGCGTGAAAGCCCCGGGCTCAACCTGGGAACCGCGCTTGAGACTGGCACGCTCGAGTTCGGGAGAGGATGGTGGAATTCCCAG0.208333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.166667
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTCCTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGGACTTGAGTACAGAAGAGAAGAGTGGAATTCCACG0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCGGCTGTGAAAACTCGGGGCTCAACCCCGAGCCTGCAGTCGATACGGGCAGACTAGAGTGCTGTAGGGGAGACTGGAATTCCTGG0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.166667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__MethylophilaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCTGTTTTGTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAATATGTCAGAGGGGGGTAGAATTCCACG0.261261
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Hyphomicrobiaceae;g__DevosiaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGCGATCTTGAGTCCGGAAGAGGTGAGTGGAACTCCTAG0.255376
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__PhenylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCTGTCTTGAGTTCGGGAGAGGTGAGTGGAATGCCGAG0.254717
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__RamlibacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTGATGTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATCGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.250000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__DyadobacterTACGGAGGGTGCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTGTTTAAGTCAGTGGTGAAATACGGTTGCTCAACAATCGAGGTGCCATTGATACTGAATAGCTTGAAATAATTGGAGGCTGCCGGAATGGATGG0.247619
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.243845
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTCCTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGGACTTGAGTGCAGAAGAGGAAAGCGGAATTCCACG0.243056
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 1TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGAAAAGCGGAATTCCACG0.242424
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACAAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.241584
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGTTTATTGGGCCTAAAGCATCCGTAGCCGGTTCTACAAGTCTTCCGTTAAATCCACCTGCTTAACAGATGGGCTGCGGAAGATACTATAGAGCTAGGAGGCGGGAGAGGCAAGCGGTACTCGATG0.241087

Annotations:

common ontology terms
term enrichment score
TermScore
rhizosphere0.991257
soil0.322753
china0.190354
cultivated environment0.171838
germany0.158775
citrus0.134293
oryza sativa0.126117
LOWER IN rhizosphere0.122297
farm0.120981
depth (soil) 0-20cm0.117376
haplic luvisol0.110964
greenhouse0.098701
saline marsh0.091275
desert0.091139
fertilized soil0.090586
root0.089739
rice0.086878
orchard0.085919
cannabis sativa0.084433
ph 70.082687
tree0.082380
triticum aestivum0.073563
silty clay loam0.070941
state of california0.070727
lettuce0.069705
thyrow0.069705
united states of america0.069243
pot expreiment0.065163
bonn0.064690
campus klein-altendorf0.064690
biochar0.064690
brazil0.064269
hunan province0.061697
topsoil0.059850
mexico0.059850
long island sound0.059621
depth (soil) 0-5cm0.057895
state of connecticut0.057895
solanum lycopersicum0.057069
LOWER IN soil0.056965
ph 4-50.056471
estuary0.056266
state of florida0.056034
greenhouse soil0.054496
spartina alterniflora0.054496
taxus0.054496
depth (soil) 0-30 cm0.054496
ph 50.053763
ph 6.90.053050
black soil0.053050
jilin province0.053050
ph 7-80.052061
maize field0.049315
hordeum vulgare0.044568
npk fertilization0.044568
LOWER IN other plants0.044077
other plants0.044077
raphanus sativus0.044077
mangrove biome0.044077
populus0.044077
fragaria x ananassa0.044077
strawberry0.044077
yellow brown soil0.044077
oak0.044077
LOWER IN root0.043939
radish0.043127
park0.043127
quercus0.043127
glycine max0.042667
kenya0.042216
mangrove0.042216
nanjing city prefecture0.042216
state of tennessee0.041344
depth (soil) 20-60cm0.039702
10 cm depth0.039161
commonwealth of virginia0.038929
temperate0.038781
agave0.038781
manured soil0.038781
canada0.038694
northeast china0.038043
switzerland0.034146
cinnamomum camphora0.033994
anxi county0.033994
jinxiang county0.033994
ph 6-70.033857
manure fertilization0.033708
minas gerais state0.033426
campos rupestres0.033426
minqin county0.033426
citrullus lanatus0.033426
co culture with wheat (triticum aestivum l.)0.033426
arachis hypogaea0.033426
peanut0.033426
campinas0.033426
flowering stage0.033426
merlot0.033426
grapevine0.033426
days 30-400.033426
ryegrass0.033426
Fraction of dbbact annotations with this term covered by the query
TermScore
rhizosphere1.063830
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
banana1.000000
musa acuminata1.000000
cinnamomum camphora1.000000
anxi county1.000000
LOWER IN high nutrient availability1.000000
LOWER IN downhill1.000000
low nutrient availability1.000000
uphill1.000000
LOWER IN low nutrient availability1.000000
LOWER IN uphill1.000000
high nutrient availability1.000000
downhill1.000000
jinxiang county1.000000
LOWER IN low npk fertilizer dose1.000000
high npk fertilizer dose1.000000
LOWER IN high npk fertilizer dose1.000000
low npk fertilizer dose1.000000
rice0.750000
oryza sativa0.714286
saline marsh0.666667
10 cm depth0.666667
silty clay loam0.666667
subtropical0.666667
LOWER IN subtropical0.666667
semi-arid0.666667
haplic luvisol0.666667
manure fertilization0.666667
hordeum vulgare0.666667
npk fertilization0.666667
fertilized soil0.600000
root0.533333
antarctic hairgrass0.500000
deschampsia antarctica0.500000
king george island0.500000
red fescue grass0.500000
festuca rubra0.500000
LOWER IN other plants0.500000
other plants0.500000
LOWER IN festuca rubra0.500000
LOWER IN red fescue grass0.500000
galium mollugo0.500000
hedge bedstraw0.500000
LOWER IN hedge bedstraw0.500000
LOWER IN galium mollugo0.500000
geranium pratense0.500000
meadow geranium0.500000
LOWER IN meadow geranium0.500000
LOWER IN geranium pratense0.500000
lathyrus pratensis0.500000
meadow pea-vine0.500000
LOWER IN meadow pea-vine0.500000
LOWER IN lathyrus pratensis0.500000
onobrychis viciifolia0.500000
common sainfoin0.500000
LOWER IN common sainfoin0.500000
LOWER IN onobrychis viciifolia0.500000
plantago lanceolata0.500000
ribwort plantain0.500000
LOWER IN ribwort plantain0.500000
LOWER IN plantago lanceolata0.500000
prunella vulgaris0.500000
woundwort0.500000
LOWER IN woundwort0.500000
LOWER IN prunella vulgaris0.500000
veronica chamaedrys0.500000
germander speedwell0.500000
LOWER IN germander speedwell0.500000
LOWER IN veronica chamaedrys0.500000
greenhouse soil0.500000
orthic anthrosol0.500000
tomato0.500000
slit loam soil0.500000
taihu lake0.500000
taihu national park0.500000
slit loam0.500000
LOWER IN bulk sediment0.500000
bulk sediment0.500000
common reed0.500000
phragmites australis0.500000
long island sound0.500000
saltmeadow cordgrass0.500000
sporobolus pumilus0.500000
smooth cordgrass0.500000
spartina alterniflora0.500000
LOWER IN saltmeadow cordgrass0.500000
LOWER IN sporobolus pumilus0.500000
LOWER IN smooth cordgrass0.500000
LOWER IN common reed0.500000
LOWER IN phragmites australis0.500000
20 cm depth0.500000
LOWER IN 20 cm depth0.500000
taxus0.500000
taxus media0.500000
LOWER IN taxus cuspidata0.500000
taxus cuspidata0.500000
LOWER IN taxus media0.500000
Fraction of annotations for the query sequences containing the term
TermScore
rhizosphere0.927954
soil0.386167
china0.357349
united states of america0.187320
germany0.161383
farm0.109510
cultivated environment0.103746
depth (soil) 0-20cm0.097983
citrus0.080692
LOWER IN rhizosphere0.072046
oryza sativa0.069164
haplic luvisol0.060519
greenhouse0.054755
tree0.051873
orchard0.051873
desert0.051873
state of california0.051873
saline marsh0.048991
fertilized soil0.048991
root0.048991
rice0.046110
triticum aestivum0.046110
ph 70.046110
canada0.046110
cannabis sativa0.046110
research facility0.043228
brazil0.040346
LOWER IN soil0.037464
silty clay loam0.037464
state of florida0.037464
pot expreiment0.037464
lettuce0.037464
thyrow0.037464
topsoil0.034582
bonn0.034582
campus klein-altendorf0.034582
mexico0.034582
hunan province0.034582
biochar0.034582
ph 7-80.034582
ph 4-50.034582
solanum lycopersicum0.031700
depth (soil) 0-5cm0.031700
long island sound0.031700
state of connecticut0.031700
estuary0.031700
greenhouse soil0.028818
spartina alterniflora0.028818
taxus0.028818
depth (soil) 0-30 cm0.028818
ph 6.90.028818
ph 50.028818
black soil0.028818
jilin province0.028818
maize field0.025937
LOWER IN other plants0.023055
other plants0.023055
raphanus sativus0.023055
radish0.023055
commonwealth of virginia0.023055
LOWER IN root0.023055
depth (soil) 20-60cm0.023055
kenya0.023055
mangrove biome0.023055
mangrove0.023055
state of tennessee0.023055
populus0.023055
fragaria x ananassa0.023055
strawberry0.023055
yellow brown soil0.023055
nanjing city prefecture0.023055
park0.023055
united kingdom0.023055
oak0.023055
quercus0.023055
glycine max0.023055
hordeum vulgare0.023055
npk fertilization0.023055
10 cm depth0.020173
northeast china0.020173
temperate0.020173
control0.020173
ph 6-70.020173
agave0.020173
israel0.020173
manured soil0.020173
switzerland0.020173
minas gerais state0.017291
campos rupestres0.017291
sand0.017291
ph 90.017291
minqin county0.017291
depth (soil) 50cm0.017291
citrullus lanatus0.017291
co culture with wheat (triticum aestivum l.)0.017291
rice field0.017291
atlantic ocean0.017291
sediment0.017291
potting mix0.017291
arachis hypogaea0.017291
Exp. ID User ID Description Date Region Flag Sequences
784amnondominant depth (soil) 0-5cm, common reed, phragmites australis, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 1
155amnonhigh freq in soil loosely bound to wheat root (dominant triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 1
793amnondominant depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 1
809amnondominant dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1
171amnondominant soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 2
76amnonhigh freq. in seleniferous soil (dominant united states of america, soil, rhizosphere, selenium, seleniferous, state of florida)2017-02-28v4No1 / 2
784amnondominant depth (soil) 0-5cm, sporobolus alterniflorus, smooth cordgrass, spartina alterniflora, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 3
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 3
793amnondominant depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v3No1 / 3
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 3
809amnondominant lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 3
462amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 3
360amnondominant desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 3
76amnonhigh freq in non-seleniferous soil (dominant soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 3
615amnondominant saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (dominant manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (dominant npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 4
415amnondominant rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 4
793amnondominant depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 4
793amnondominant depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 4
415amnondominant rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 4
760sheryoDominant in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (dominant ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 4
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 4
1008amnon high in soil compared to rhizosphere in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 2023-01-26v4No1 / 4
309amnondominant rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 5
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 5
942amnondominant musa acuminata, china, nanning city prefecture, rhizosphere, banana2022-11-25v3No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments amended with biochar (dominant biochar, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments unamended with biochar (dominant china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
1008amnondominant rhizosphere, china, farm, fertilized soil, allium sativum, garlic, jinxiang county, ph 7-82023-01-26v4No1 / 5
34amnonhigh freq. in mangrove rhizosphere (dominant mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 6
548amnondominant minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 6
792amnondominant depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 6
415amnondominant rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 6
415amnondominant rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 6
156amnondominant soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 6
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 6
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 6
462amnondominant depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 6
933amnondominant quaternary laterite soil, pumpkin, cucurbita moschata, china, ph 5.5, guangxi zhuang autonomous region, rhizosphere, research facility2022-09-11v3No1 / 6
989amnon high in low nutrient availability uphill compared to high nutrient availability downhill in rhizosphere depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china 2022-12-26v3No1 / 6
631sheryodominant in maize field unamended rhizosphere soil (dominant unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 6
145amnondominant soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 7
792amnondominant depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 7
415amnondominant rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 7
98amnondominant citrus, rhizosphere, pierce, fl, state of florida, root2017-04-01v4No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild rice (Oryza rufipogon) rhizosphere (dominant oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 7
882amnondominant antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 8
309amnondominant rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 8
134amnondominant rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 8
415amnondominant rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 8
531amnondominant rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 8
376amnondominant rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 8
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 8
98amnondominant citrus, rhizosphere, quincy, fl, state of florida, root2017-04-01v4No1 / 8
618amnondominant early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 8
989amnon high in high nutrient availability downhill compared to low nutrient availability uphill in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm rhizosphere 2022-12-26v3No1 / 8
415amnondominant rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 8
129amnondominant mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 8
882amnondominant antarctic pearlwort, colobanthus quitensis, king george island, antarctica, rhizosphere2022-03-20v3No1 / 8
309amnondominant rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 9
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 9
415amnondominant rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil inucolated with Fusarium oxysporum f. sp. niveum (dominant inoculated with fusarium oxysporum f. sp. niveum, ph 7, co culture with wheat (triticum aestivum l.), citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil (dominant co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 9
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 9
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 9
360amnondominant desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 9
479amnondominant rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 9
479amnondominant rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
98amnondominant citrus, rhizosphere, immokalee, fl, state of florida, root2017-04-01v4No1 / 9
98amnondominant citrus, rhizosphere, gainesville, fl, state of florida, root2017-04-01v4No1 / 9
271amnondominant depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 9
309amnondominant rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 10
309amnondominant rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 10
820naDominant in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 10
618amnondominant pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 10
309amnondominant lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 11
309amnondominant rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 11
146amnondominant united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 11
444amnon high in spring compared to winter in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
755sheryodominant in domesticated rice (Oryza stavia) rhizosphere (dominant oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 11
989amnondominant china, farm, ph 4-5, anxi county, cinnamomum camphora, depth (soil) 0-20cm, rhizosphere2022-12-26v3No1 / 11
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 12
360amnondominant desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 12
618amnondominant late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 12
309amnondominant rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 13
675sheryoHigher in watermelon rhizosphere soil uninoculated compared to watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum ( high in un-inoculated compared to inoculated with fusarium oxysporum f. sp. niveum in co culture with wheat (triticum aestivum l.) ph 7 citrullus lanatus rhizosphere china )2028-02-22v4No1 / 13
98amnondominant citrus, rhizosphere, vero beach, fl, state of florida, root2017-04-01v4No1 / 13
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 13
820nadominant in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (dominant silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 14
602sheryocommon in rhizoshere of tomato plant roots planted in potting mix amended with biochar (common ph 7.3, potting mix, biochar, solanum lycopersicum, israel, rhizosphere)2020-04-03v4No1 / 14
602sheryocommon rhizosphere, soil, israel, solanum lycopersicum, biochar2020-04-03v4No1 / 14
602sheryodominant in rhizoshere of tomato plant roots planted in potting mix amended with biochar (dominant ph 7.3, potting mix, biochar, rhizosphere, israel, solanum lycopersicum)2020-04-05v4No1 / 14
129amnon high in rhizosphere compared to soil in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 14
373amnondominant soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 15
126amnondominant rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 15
893amnondominant silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 16
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 16
698amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 17
602sheryocommon in rhizoshere of tomato plant roots planted in unamended potting mix (common ph 6.5, unamended, potting mix, solanum lycopersicum, israel, rhizosphere)2020-04-03v4No1 / 17
602sheryodominant in rhizoshere of tomato plant roots planted in unamended potting mix (dominant ph 6.5, potting mix, unamended, rhizosphere, israel, solanum lycopersicum)2020-04-03v4No1 / 17
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 17
893amnondominant sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (dominant pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (dominant organic fertilization, manure fertilization, manured soil, pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 21
101amnon high in rhizosphere compared to soil in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 26
1008amnon high in rhizosphere compared to soil in ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 29
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 30
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in triticum aestivum wheat soil china )2017-07-02v4No1 / 31
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
762sheryoHigh in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in mineral fertilization npk fertilization compared to organic fertilization manure fertilization manured soil bio-dynamic fertilizer in thyrow switzerland haplic luvisol pot expreiment lettuce soil rhizosphere )2021-04-08v3No1 / 40
373amnon high in rhizosphere compared to soil in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 48
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 59
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
989amnon high in rhizosphere compared to soil in depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china 2022-12-26v3No1 / 69
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 73
34amnonhigher in 10cm, 20cm depth compared to 0cm ( high in 10 cm depth 20 cm depth compared to topsoil in mangrove swamp rhizosphere china )2016-12-06v4No1 / 75
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 81
820naHigher in 45-5cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 83
618amnon high in cbd yummy cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 83
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 88
360amnon high in spring compared to summer in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 97
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
34amnonhigher in 0cm depth compared to 10cm, 20cm depth ( high in topsoil compared to 10 cm depth 20 cm depth in mangrove swamp rhizosphere china )2016-12-06v4No1 / 106
631sheryoHigher in maize field biochar amended rhizosphere soil compared to unamended rhizosphere soil ( high in biochar compared to unamended soil in rhizosphere china guizhou province kaiyang county soil maize field after 6 years )2020-06-02v3No1 / 108
309amnon high in other plants compared to hedge bedstraw galium mollugo in rhizosphere germany 2018-04-05v4No1 / 110
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
373amnon high in soil compared to rhizosphere in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 111
792amnon high in rhizosphere nitraria tangutorum haloxylon ammodendron compared to soil in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 118
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 122
1008amnon high in high npk fertilizer dose compared to low npk fertilizer dose in rhizosphere ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 123
462amnon high in soil compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 131
1008amnon high in low npk fertilizer dose compared to high npk fertilizer dose in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 rhizosphere 2023-01-26v4No1 / 135
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in co culture with wheat (triticum aestivum l.) ph 7 citrullus lanatus rhizosphere china )2028-02-22v4No1 / 136
618amnon high in cbd shark cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 139
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 139
893amnoncommon silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 140
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
893amnoncommon sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 142
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 152
820naHigher in 75-105cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 159
376amnoncommon rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora2018-09-11v4No1 / 161
376amnonappear when transferred from high salinity to low salinity (other rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora)2018-09-11v4No1 / 161
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 190
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 191
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
618amnon high in cbd shark cannabis plant compared to hash cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 197
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 200
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
784amnoncommon depth (soil) 0-5cm, common reed, phragmites australis, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 204
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 214
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 226
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 243
101amnon high in soil compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 249
618amnon high in cbd yummy cannabis plant compared to hash cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
602sheryohigher in rhizoshere of tomato plant roots planted in unamended potting mix ( high in unamended compared to amended with biochar in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 252
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
698amnon high in ph 5-6 plant disease disease acute oak decline compared to ph 6-7 control in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 266
309amnon high in other plants compared to meadow geranium geranium pratense in rhizosphere germany 2018-04-05v4No1 / 267
784amnon high in common reed phragmites australis compared to saltmeadow cordgrass sporobolus pumilus in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 267
602sheryohigher in rhizoshere of tomato plant roots planted in potting mix amended with biochar ( high in amended with biochar compared to unamended in potting mix rhizosphere israel solanum lycopersicum )2020-04-05v4No1 / 270
784amnon high in saltmeadow cordgrass sporobolus pumilus compared to smooth cordgrass sporobolus alterniflorus spartina alterniflora in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 277
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
882amnoncommon antarctic hairgrass, deschampsia antarctica, king george island, antarctica, rhizosphere2022-03-20v3No1 / 299
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
309amnon high in other plants compared to meadow pea-vine lathyrus pratensis in rhizosphere germany 2018-04-05v4No1 / 316
882amnoncommon king george island, antarctic pearlwort, colobanthus quitensis, antarctica, rhizosphere2022-03-20v3No1 / 325
129amnoncommon mexico, myrtillocactus geometrizans, opuntia robusta, cactus, rhizosphere, semi-arid2017-04-15v4No1 / 338
309amnon high in other plants compared to ribwort plantain plantago lanceolata in rhizosphere germany 2018-04-05v4No1 / 352
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
309amnon high in other plants compared to common sainfoin onobrychis viciifolia in rhizosphere germany 2018-04-05v4No1 / 355
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
784amnon high in smooth cordgrass spartina alterniflora sporobolus alterniflorus compared to saltmeadow cordgrass sporobolus pumilus in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 380
784amnoncommon depth (soil) 0-5cm, saltmeadow cordgrass, sporobolus pumilus, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 382
309amnon high in other plants compared to festuca rubra red fescue grass in rhizosphere germany 2018-04-05v4No1 / 383
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
309amnon high in other plants compared to germander speedwell veronica chamaedrys in rhizosphere germany 2018-04-05v4No1 / 404
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in flowering stage rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 416
309amnon high in onobrychis viciifolia common sainfoin compared to other plants in rhizosphere germany 2018-04-05v4No1 / 420
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 432
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 443
989amnon high in soil compared to rhizosphere in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 448
698amnon high in ph 6-7 control compared to ph 5-6 disease plant disease acute oak decline in depth (soil) 0-30 cm depth (soil) 0-20cm park united kingdom oak quercus rhizosphere 2028-04-01v3No1 / 452
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
989amnoncommon rhizosphere, depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china2022-12-26v3No1 / 476
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
376amnondisappear when transferred from high salinity to low salinity (other rhizosphere, saline marsh, united states of america, atlantic ocean, sediment, spartina alterniflora)2018-09-11v4No1 / 494
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
942amnoncommon banana, rhizosphere, nanning city prefecture, china, musa acuminata2022-11-25v3No1 / 505
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
784amnoncommon depth (soil) 0-5cm, sporobolus alterniflorus, smooth cordgrass, spartina alterniflora, rhizosphere, long island sound, state of connecticut, topsoil, united states of america, estuary, saline marsh2021-05-16v4No1 / 511
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
618amnoncommon pre-vegetative stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 530
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
376amnonlower in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in high salinity compared to low salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 533
618amnon high in late flowering stage compared to early flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 533
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
309amnon high in other plants compared to woundwort prunella vulgaris in rhizosphere germany 2018-04-05v4No1 / 550
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
784amnon high in saltmeadow cordgrass sporobolus pumilus compared to common reed phragmites australis in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 581
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
309amnon high in prunella vulgaris woundwort compared to other plants in rhizosphere germany 2018-04-05v4No1 / 617
309amnon high in galium mollugo hedge bedstraw compared to other plants in rhizosphere germany 2018-04-05v4No1 / 618
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 4-4.5, park, london, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 623
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 648
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
793amnoncommon depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 662
309amnon high in lathyrus pratensis meadow pea-vine compared to other plants in rhizosphere germany 2018-04-05v4No1 / 680
820naHigher in 45-75cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 686
309amnon high in geranium pratense meadow geranium compared to other plants in rhizosphere germany 2018-04-05v4No1 / 688
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 700
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
793amnoncommon depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 733
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 740
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
309amnon high in red fescue grass festuca rubra compared to other plants in rhizosphere germany 2018-04-05v4No1 / 781
309amnon high in plantago lanceolata ribwort plantain compared to other plants in rhizosphere germany 2018-04-05v4No1 / 800
618amnoncommon late flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 819
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, ph 5-6, disease, plant disease, acute oak decline, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 848
618amnoncommon early flowering stage, rhizosphere, canada, farm, cannabis sativa2020-05-04v4No1 / 873
146amnoncommon united states of america, solanum lycopersicum, tomato, slit loam soil, ph 6, rhizosphere2017-04-20v4No1 / 894
793amnoncommon depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v3No1 / 900
479amnoncommon rhizosphere, united states of america, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, depth 30-75cm, silt clay loam, rhizosphere, populus, tree, cultivated environment2019-01-13v4No1 / 908
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 917
784amnon high in common reed phragmites australis compared to smooth cordgrass spartina alterniflora sporobolus alterniflorus in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 918
820naHigher in 0-20cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 923
126amnoncommon rhizosphere, germany, hordeum vulgare, winter barley2017-04-14v4No1 / 925
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment2019-01-13v4No1 / 997
793amnoncommon depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v3No1 / 1001
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
479amnoncommon rhizosphere, united states of america, state of california, heteromeles arbutifolia, ph 6-72019-02-05v4No1 / 1006
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 1011
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in rhizosphere saline marsh united states of america atlantic ocean sediment spartina alterniflora )2018-09-11v4No1 / 1038
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
618amnon high in early flowering stage compared to late flowering stage in rhizosphere canada farm cannabis sativa 2020-05-04v4No1 / 1040
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
698amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, control, ph 6-7, park, united kingdom, oak, quercus, rhizosphere2028-04-01v3No1 / 1115
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
171amnon high in control compared to drought environment in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 1164
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
309amnoncommon rhizosphere, germany, prunella vulgaris, woundwort2018-04-05v4No1 / 1217
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
901amnon high in bulk sediment compared to rhizosphere in taihu lake depth (sediment) 0-20cm depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1228
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
309amnon high in veronica chamaedrys germander speedwell compared to other plants in rhizosphere germany 2018-04-05v4No1 / 1272
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
309amnoncommon lathyrus pratensis, rhizosphere, germany, meadow pea-vine2018-04-05v4No1 / 1296
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
309amnoncommon rhizosphere, germany, onobrychis viciifolia, common sainfoin2018-04-05v4No1 / 1323
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
309amnoncommon rhizosphere, germany, plantago lanceolata, ribwort plantain2018-04-05v4No1 / 1386
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
784amnon high in smooth cordgrass sporobolus alterniflorus spartina alterniflora compared to common reed phragmites australis in depth (soil) 0-5cm rhizosphere long island sound state of connecticut topsoil united states of america estuary saline marsh 2021-05-16v4No1 / 1421
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
309amnoncommon rhizosphere, germany, geranium pratense, meadow geranium2018-04-05v4No1 / 1434
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
309amnoncommon rhizosphere, germany, festuca rubra, red fescue grass2018-04-05v4No1 / 1510
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
309amnoncommon rhizosphere, germany, galium mollugo, hedge bedstraw2018-04-05v4No1 / 1599
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
309amnoncommon rhizosphere, germany, veronica chamaedrys, germander speedwell2018-04-05v4No1 / 1788
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, rhizosphere2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org