Summary for ontology term: rock

Number of annotations with term: 40

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTACGGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCCGCAGGTGGCAATTCAAGTTTGCGGTTAAAGGTCCTGGCTCAACCAGGGACAGGCCGTGAAAACTGAATAGCTAGAGTATGGTAGGGGCAGAGGGAATTCCCAG0.025000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.025000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family VIII;g__GpVIIITACGGAGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGTCCGCAGGTGGTTAATCAAGTCTGCTGTTAAAGACAGAAGCTCAACTTCTGGTCGGCAGTGGAAACTGGTGAACTAGAGTACGGTAGGGGTTGAGGGAATTCCCAG0.025000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Geodermatophilaceae;g__BlastococcusTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTGCGTCGGCTGTGAAAACCTGAGGCTCAACCTCAGGCCTGCAGTCGATACGAGCAGACTAGAGTGTTGCAGGGGAGACTGGAATTCCTGG0.025000
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__"Rubritaleaceae";g__RubritaleaTACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGGGAGCGTAGGCGGCGTGGAAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATCCGATACTACCATGCTAGAGTATTGGAGGGGTAACTGGAATTCTCGG0.025000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Erythrobacteraceae;g__PorphyrobacterTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCCTTGAAACTGGGAAGCTAGAATCTTGGAGAGGCGAGTGGAATTCCGAG0.025000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACACTGGGCTTAACCGAGTGCTTGCTTTCGATACGGGCAGACTTGAGGCATTGAGGGGAGAACGGAATTCCTGG0.025000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FlavobacteriumTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGCTTTATAAGTCAGTGGTGAAATCTCCCCGCTCAACGGGGAAACGGCCATTGATACTGTAAGGCTTGAATTATTAGGAAGTAACTAGAATATGTAG0.025000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__HydrogenophagaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGTCGTGAAATCCCCGGGCTCAACCTGGGAATGGCGATTGTGACTGCAAAGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.025000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingorhabdusTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTATTCAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAAACTAGATAACTAGAATCTTGGAGAGGTGAGTGGAATTCCGAG0.025000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACCAGTTAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTGCTGGTCTGGAGGTCGAGAGAGGTGAGTGGAATTCCGAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FlavobacteriumTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTTGTAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGGCCATTGATACTGCAAGACTTGAATTATTAGGAAGTAACTAGAATATGTAG0.500000
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGTGTAGGTGGTCGAGTAAGTCGAATGTGAAAGCCCCGGGCTCAACCCGGGAAGTGCATCCGAAACTGCTCGACTAGAGTCCCGGAGAGGAAGGCAGAATTCCCAA0.500000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCGAACGTTAATCGGAATCACTGGGCGTAAAGCGCGCGTAGGCGGTCTGTTAAGTGGGATGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCAAACTGGCCGACTAGAGTACGGTAGAGGGAGGTAGAATTTCCTG0.500000
d__BacteriaTACGGAGGGTGCAAGCGTTGTTCGGATTCATTGGGCGTAAAGCGAGTGTAGGCGGTTTGACAAGTCGGATGTGAAATCCCGGGGCCCAACCCCGGAACTGCATCCGATACTGTCTGGCTAGAGTCCCGGAGAGGGTGGCGGAATTCCCGG0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__PaludibaculumTACGTAGGCAGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGAGTGCGTAGGCGGTTAACTAAGTTTGGTGTGAAATCTCCCGGCTTAACTGGGAGGGTGCGCCGAAAACTGGCTAGCTAGAGTGTGGGAGAGGATAGTGGAATTCCTGG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__RhodoferaxTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGACCTGCATTTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.500000
d__BacteriaTACAGAGGTGGCGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGCCCCGTGTGTCGGATGTGAAAGCCCATGGCTCAACCATGGAATGGCATCCGAAACTGCGGGGCTAGAGTGCAGGAGAGGAGAGTGGAATTCTTGG0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGGTAAGTCTGGTGTGAAATCTCCACGCTCAACGTGGAGGGGCCACCCGATACTGCCATGACTGGAGTCCGGTAGAGGAGTGTGGAATTCCCG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family IV;g__GpIVGACGGAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGCAGGCGGCTTTTTAAGTCTGTTGTCAAAGCCCACAGCTCAACTGTGGATCGGCAATGGAAACTGGGAAGCTAGAGTGTGGTAGGGGTAGAGGGAATTCCCGG0.235294
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGGGTAGGCGGCACTGCAAGTCGACTGTGAAATCTCCGAGCTTAACTCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCGG0.217391
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGCAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCTTTAAAACTGCATCGCTAGAATTGTGGAGAGGTGAGTGGAATTCCGAG0.217391
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaGACGGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGCAGGTGGCTGTTCAAGTCTGCTGTCAAATTCCAGGGCTCAACCCTGGTTCGGCAGTGGAAACTGGATAGCTAGAGTACGGTAGGGGCAGAGGGAATTCCTGG0.204082
d__BacteriaTACGTAGGATGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGCGCGCGCAGGCGGCACTACAAGTAAGGTGTGAAATCTCCCTGCTCAACGGGGAGGGTGCACTTTAGACTGTAGAGCTAGAGGTCGGTAGAGGGGGGTGGAATTGCTGG0.196078
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCGAACGTGAAATCCCTGGGCTCAACCCAGGAACTGCGTCCGATACTGGTTGGCTTGAATCCGGGAGAGGGATGTGGAATTCCAGG0.192308
d__Bacteria;p__"Armatimonadetes";c__Chthonomonadetes;o__Chthonomonadales;f__Chthonomonadaceae;g__Chthonomonas/Armatimonadetes_gp3TACGGAGGTGGCGAGCGTTGTCCGAAGTTACTGGGCGTAAAGCGCGCGTAGGCGGGCCCTTAAGTGAGGGGTGAAAGGCTGAGGCTCAACCTCATGTTTGTCCTCTCATACTGTGGGTCTTGAGTGAGGCAGGGAGAAGTGGAATGGCTG0.188679
d__BacteriaTACGTAGGGGCCGAGCGTTGTCCGGAGTTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCGCGCGCCCGACGTGAAAGCCCCCGGCTTAACCGGGGAGAGTCGTTGGGGACGGCGGGGCTTGAGGGCGGGAGAGGTCGGTGGAATTCCCGG0.178571
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__TerrimonasTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGTTGGTAAGTCAGTGGTGAAATCTCCAGGCTTAACTTGGAAACTGCCATTGATACTATCAGTCTTGAATACCGTGGAGATGAGCGGAATATGTCA0.178571
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGCAGGCGGATTATTAAGTCAGTGGTGAAATCCCGGGGCTCAACCCTGGAACTGCCATTGATACTGGTAATCTTGAATACGGTTGAAGTGGGCGGAATGTAGCA0.177778

Annotations:

common ontology terms
term enrichment score
TermScore
rock0.487179
difenoconazole0.375000
fungicide0.375000
tobacco field0.375000
limestone0.375000
depth 0-20cm0.315789
quarry0.285714
hydrothermal vent0.230769
greece0.230769
marine hydrothermal vent0.230769
volcanic rock0.230769
volcanic crater0.230769
calvert island0.230769
province of british columbia0.187500
duluth complex0.166667
greenschist0.166667
without plants0.166667
tobacco plant present0.166667
mediterranean sea0.157895
sulfide0.153846
state of minnesota0.133333
ph 70.133333
active vent0.130435
inactive vent0.130435
epilithic0.130435
low tide zone0.130435
high tide zone0.130435
biochar0.125000
biofilm0.111111
depth 2.5cm0.090909
LOWER IN depth 2.5cm0.090909
sandstone0.090909
grand staircase-escalante national park0.090909
depth (soil) 0-1cm0.090909
minas gerais state0.090909
campos rupestres0.090909
river0.090909
ph 7-80.089552
ocean0.088235
LOWER IN depth0.086957
depth0.086957
ph 4-50.086957
marine sediment0.084507
LOWER IN depth (soil) 15cm0.083333
depth (soil) 15cm0.083333
state of utah0.083333
desert0.071429
kingdom of spain0.064516
pacific ocean0.061224
canada0.054545
brazil0.051282
LOWER IN active vent0.047619
LOWER IN inactive vent0.047619
epipsammic0.047619
LOWER IN epilithic0.047619
LOWER IN epipsammic0.047619
LOWER IN high tide zone0.047619
LOWER IN low tide zone0.047619
absence of tobacco plants0.047619
LOWER IN presence of tobacco plants0.047619
presence of tobacco plants0.047619
LOWER IN absence of tobacco plants0.047619
sea water0.046875
sand0.042553
LOWER IN sand0.042553
LOWER IN rock0.041667
sediment0.037037
water0.032432
soil0.019169
united states of america0.014981
china0.010619
Fraction of dbbact annotations with this term covered by the query
TermScore
rock0.500000
quarry0.500000
duluth complex0.500000
depth 2.5cm0.500000
greenschist0.500000
LOWER IN depth 2.5cm0.500000
hydrothermal vent0.500000
greece0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
inactive vent0.500000
LOWER IN active vent0.500000
LOWER IN inactive vent0.500000
sandstone0.500000
grand staircase-escalante national park0.500000
depth (soil) 0-1cm0.500000
epipsammic0.500000
LOWER IN epilithic0.500000
epilithic0.500000
LOWER IN epipsammic0.500000
calvert island0.500000
low tide zone0.500000
LOWER IN high tide zone0.500000
high tide zone0.500000
LOWER IN low tide zone0.500000
without plants0.500000
difenoconazole0.500000
fungicide0.500000
tobacco field0.500000
limestone0.500000
minas gerais state0.500000
campos rupestres0.500000
tobacco plant present0.500000
absence of tobacco plants0.500000
LOWER IN presence of tobacco plants0.500000
presence of tobacco plants0.500000
LOWER IN absence of tobacco plants0.500000
sulfide0.333333
LOWER IN depth0.333333
depth0.333333
depth 0-20cm0.333333
LOWER IN depth (soil) 15cm0.250000
depth (soil) 15cm0.250000
state of utah0.250000
province of british columbia0.250000
ph 70.200000
mediterranean sea0.166667
sand0.142857
LOWER IN sand0.142857
desert0.125000
LOWER IN rock0.125000
biochar0.125000
state of minnesota0.100000
river0.083333
ph 4-50.076923
biofilm0.076923
ocean0.062500
marine sediment0.058824
ph 7-80.052632
brazil0.052632
kingdom of spain0.047619
pacific ocean0.038462
canada0.033333
sediment0.029412
sea water0.027778
water0.018182
soil0.009901
united states of america0.007722
china0.005405
Fraction of annotations for the query sequences containing the term
TermScore
rock0.475000
difenoconazole0.300000
fungicide0.300000
ph 7-80.300000
china0.300000
tobacco field0.300000
limestone0.300000
depth 0-20cm0.300000
soil0.300000
united states of america0.250000
quarry0.200000
state of minnesota0.200000
biofilm0.200000
hydrothermal vent0.150000
greece0.150000
marine sediment0.150000
mediterranean sea0.150000
marine hydrothermal vent0.150000
volcanic rock0.150000
volcanic crater0.150000
water0.150000
sea water0.150000
canada0.150000
province of british columbia0.150000
calvert island0.150000
pacific ocean0.150000
ocean0.150000
biochar0.125000
duluth complex0.100000
ph 4-50.100000
sulfide0.100000
ph 70.100000
greenschist0.100000
kingdom of spain0.100000
river0.100000
without plants0.100000
tobacco plant present0.100000
active vent0.075000
inactive vent0.075000
epilithic0.075000
low tide zone0.075000
high tide zone0.075000
depth 2.5cm0.050000
LOWER IN depth (soil) 15cm0.050000
LOWER IN depth0.050000
depth0.050000
depth (soil) 15cm0.050000
LOWER IN depth 2.5cm0.050000
state of utah0.050000
sandstone0.050000
grand staircase-escalante national park0.050000
desert0.050000
depth (soil) 0-1cm0.050000
sediment0.050000
minas gerais state0.050000
campos rupestres0.050000
brazil0.050000
LOWER IN active vent0.025000
LOWER IN inactive vent0.025000
epipsammic0.025000
sand0.025000
LOWER IN epilithic0.025000
LOWER IN rock0.025000
LOWER IN sand0.025000
LOWER IN epipsammic0.025000
LOWER IN high tide zone0.025000
LOWER IN low tide zone0.025000
absence of tobacco plants0.025000
LOWER IN presence of tobacco plants0.025000
presence of tobacco plants0.025000
LOWER IN absence of tobacco plants0.025000
Exp. ID User ID Description Date Region Flag Sequences
205amnonhigh freq. in Ely Greenstone rock piles (dominant rock, united states of america, quarry, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 5
548amnondominant minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 5
252amnonhigh freq. in river rock biofilm (dominant biofilm, river, rock, biofilm, kingdom of spain, epilithic)2017-11-22v4No1 / 8
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, biochar)2020-04-21v4No1 / 9
514amnondominant united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 10
355amnonhigh freq. in rocks from low tide zone (dominant canada, province of british columbia, calvert island, pacific ocean, ocean, rock, low tide zone)2018-08-01v4No1 / 11
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 12
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
355amnoncommon in rocks from high tide zone (dominant canada, province of british columbia, calvert island, pacific ocean, ocean, rock, high tide zone)2018-08-01v4No1 / 17
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 18
205amnonhigh freq. in rock piles from duluth complex (dominant rock, united states of america, quarry, duluth complex, ph 4-5, state of minnesota, sulfide)2017-10-03v4No1 / 18
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in biofilm kingdom of spain biofilm river sediment )2017-11-22v4No1 / 56
355amnonlower in rocks from low tide zone compared to high tide zone ( high in high tide zone compared to low tide zone in canada province of british columbia calvert island pacific ocean ocean rock )2018-08-01v4No1 / 62
355amnonhigher in rocks from low tide zone compared to high tide zone ( high in low tide zone compared to high tide zone in canada province of british columbia calvert island pacific ocean ocean rock )2018-08-01v4No1 / 74
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 78
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth (soil) 15cm depth compared to depth 2.5cm in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 120
362amnon high in inactive vent compared to active vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 129
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
514amnoncommon united states of america, state of utah, sandstone, grand staircase-escalante national park, desert, depth (soil) 0-1cm2019-03-25v4No1 / 139
355amnoncommon in rocks from high tide zone (common canada, province of british columbia, calvert island, pacific ocean, ocean, rock, high tide zone)2018-08-01v4No1 / 148
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
205amnoncommon in rock piles from duluth complex (common rock, united states of america, quarry, duluth complex, ph 4-5, state of minnesota, sulfide)2017-10-03v4No1 / 205
355amnoncommon in rocks from low tide zone (common canada, province of british columbia, calvert island, pacific ocean, ocean, rock, low tide zone)2018-08-01v4No1 / 206
205amnoncommon in Ely Greenstone rock piles (common rock, united states of america, quarry, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth (soil) 15cm depth in rock united states of america quarry duluth complex ph 4-5 state of minnesota sulfide )2017-10-03v4No1 / 265
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in epipsammic sand compared to epilithic rock in biofilm kingdom of spain biofilm river sediment )2017-11-22v4No1 / 374
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 480
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in rock united states of america quarry state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
252amnoncommon in river rock biofilm (common biofilm, kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org