Summary for ontology term: root

Number of annotations with term: 77

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.035714
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTAAGTTAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.030612
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.025510
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.025510
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Mycobacteriaceae;g__MycobacteriumTACGTAGGGTCCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAAACTCACAGCTTAACTGTGGGCGTGCGGGCGATACGGGCAGACTTGAGTACTGCAGGGGAGACTGGAATTCCTGG0.025510
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGATTGTGAAAGCCCGAGGCTTAACCTCGGGTCTGCAGTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.025510
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCGGATGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCAGACTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.025510
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGCAGGCGGATTGATAAGTCGGGGGTGAAATCCCGGGGCTCAACCTCGGAATTGCCTTCGATACTGTCTGTCTTGAGTCCGGGAGAGGTGAGTGGAATTCCTAG0.025510
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__RhizobiumTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGATCAGTCAGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTGATACTGTCGATCTGGAGTATGGAAGAGGTGAGTGGAATTCCGAG0.020408
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.020408

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGGGCTCAACTCCGGAATTGCCTTTAAGACTGCATCGCTAGAATTGTGGAGAGGTAAGTGGAATTCCGAG0.189189
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.189189
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGTAGGCGGAGATCTAAGCGTGGCCTGAAAGCCCCCGGCTCAACCGGGGAGTGCGGCTGCGAACTGGGTTTCTTGAGGACGATAGAGGAGAGTGGAATTCCTGG0.189189
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCGCCAAGTCAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCGCTTGAAACTAGCGGGCTTGAGTGCGGCAGAGGGGGGTGGAATTCCACG0.189189
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGCGCGTTAAGACAGGTGTGAAAGCCCCGAGCTTAACTTGGGAATTGCGCTTGTGACTGGCGTGCTGGAGTGTGGCAGAGGGAGGTGGAATTCCACG0.162162
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__RamlibacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTGATGTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATCGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.162162
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCAGGGCTCAACCCTGGAATTGCCTTTAAGACTGCATCGCTTGAACATCGGAGAGGTAAGTGGAATTCCGAG0.162162
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__RamlibacterTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTGATGTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGCATCGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.162162
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.162162
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGTGGCTGAGTCAGTCGATTGTGAAAGCCCTGGGCTTAACCTGGGAATTGCAGTCGATACTACTCAGCTAGAGTATGGGAGAGGGTAGTGGAATTCCCGG0.162162

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGATTGTGAAAGCCCGAGGCTTAACCTCGGGTCTGCAGTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.147436
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCAGGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.131868
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.128617
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__MassiliaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCTGTCGTGAAAGCCCCGGGCTTAACCTGGGAATTGCGATGGAGACTGCAAGGCTTGAATCTGGCAGAGGGGGGTAGAATTCCACG0.127660
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingomonasTACGGAGGGAGCTAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTAAGACTGCATCGCTTGAATCCAGGAGAGGTGAGTGGAATTCCGAG0.122034
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTAAGTTAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.121622
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Streptomycetaceae;g__StreptomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCACGTCGGGTGTGAAAGCCCGGGGCTTAACCCCGGGTCTGCATTCGATACGGGCTAGCTAGAGTGTGGTAGGGGAGATCGGAATTCCTGG0.116466
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.116279
d__BacteriaTACGTAGAAGACGAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACGGAAAATCAAGCCATAGTAGGGACTAATTTTCTAGAGTTTTATAGGTGAAGATCGAATTACCTGAGGAGCGATGGAATGCATTGATACAGGTAAGAC0.115556
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGACGGTTATGTAAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTGAGACTGCATAGCTAGGGTGCGGAAGAGGGAAGCGGAATTTCCGG0.115385

Annotations:

common ontology terms
term enrichment score
TermScore
root0.886508
root endosphere0.341137
LOWER IN root0.252632
cannabis sativa0.206186
rhizosphere0.196990
marine eelgrass0.179775
zostera marina0.179775
boechera stricta0.172043
state of idaho0.158416
citrus0.157480
cultivated environment0.146789
state of california0.137931
bodega bay0.134831
minas gerais state0.134831
campos rupestres0.134831
populus0.134831
agave0.134831
rice0.118812
brazil0.116279
merlot0.114943
grapevine0.114943
ocean0.113475
LOWER IN rhizosphere0.112903
state of tennessee0.112150
vitis vinifera0.108696
brassicaceae0.107383
oryza sativa0.100840
mexico0.100503
desert0.096000
vellozia epidendroides0.094118
guanajuato0.094118
campinas0.094118
saccharum0.089888
sugarcane0.089888
tree0.087591
wheat0.082474
greenhouse0.079208
state of florida0.077821
state of new york0.070423
soybean0.069767
plant0.068966
endosphere0.067416
triticum aestivum0.066116
glycine max0.061224
canada0.053050
quincy, fl0.049383
immokalee, fl0.049383
gainesville, fl0.049383
propagation stage0.049383
pre-vegetative stage0.049383
early flowering stage0.049383
late flowering stage0.049383
rhizome0.049383
barbacenia macrantha0.049383
agave deserti0.049383
agave salmiana0.049383
agave tequiliana0.049383
vero beach, fl0.049383
root structure0.047059
seedling0.047059
farm0.044743
soil0.043011
leaf0.040816
LOWER IN leaf0.040816
depth (soil) 0-20cm0.030000
united states of america0.029485
pierce, fl0.025316
myrtillocactus geometrizans0.025316
opuntia robusta0.025316
root interior0.025316
populus deltoides0.025316
LOWER IN populus trichocarpa x deltoides0.025316
populus trichocarpa x deltoides0.025316
LOWER IN populus deltoides0.025316
ft. pierce, fl0.025316
root nodule0.025000
cactus0.025000
semi-arid0.025000
drought environment0.025000
LOWER IN drought environment0.025000
LOWER IN root structure0.024691
LOWER IN root endosphere0.024691
LOWER IN endosphere0.024691
LOWER IN bulk soil0.023810
bulk soil0.023810
LOWER IN marine sediment0.021277
marine sediment0.021277
china0.019324
LOWER IN sediment0.018018
sediment0.018018
LOWER IN soil0.011236
LOWER IN control0.007491
control0.007491
Fraction of dbbact annotations with this term covered by the query
TermScore
root0.933333
root endosphere0.750000
LOWER IN root0.666667
marine eelgrass0.666667
zostera marina0.666667
quincy, fl0.500000
immokalee, fl0.500000
pierce, fl0.500000
gainesville, fl0.500000
propagation stage0.500000
cannabis sativa0.500000
pre-vegetative stage0.500000
early flowering stage0.500000
late flowering stage0.500000
myrtillocactus geometrizans0.500000
opuntia robusta0.500000
root interior0.500000
merlot0.500000
grapevine0.500000
rhizome0.500000
bodega bay0.500000
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
barbacenia macrantha0.500000
populus0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
agave0.500000
agave deserti0.500000
agave salmiana0.500000
guanajuato0.500000
agave tequiliana0.500000
campinas0.500000
boechera stricta0.500000
vero beach, fl0.500000
ft. pierce, fl0.500000
soybean0.333333
root nodule0.333333
cactus0.333333
semi-arid0.333333
vitis vinifera0.333333
drought environment0.333333
LOWER IN drought environment0.333333
saccharum0.333333
sugarcane0.333333
state of idaho0.333333
root structure0.250000
LOWER IN root structure0.250000
seedling0.250000
LOWER IN root endosphere0.250000
cultivated environment0.250000
rice0.250000
endosphere0.250000
LOWER IN endosphere0.250000
mexico0.222222
citrus0.200000
wheat0.200000
state of tennessee0.200000
rhizosphere0.170213
greenhouse0.166667
LOWER IN rhizosphere0.148936
glycine max0.142857
LOWER IN bulk soil0.142857
bulk soil0.142857
oryza sativa0.142857
ocean0.125000
desert0.125000
state of california0.111111
brassicaceae0.111111
brazil0.105263
tree0.100000
leaf0.095238
LOWER IN leaf0.095238
triticum aestivum0.090909
state of new york0.076923
LOWER IN marine sediment0.058824
marine sediment0.058824
state of florida0.055556
plant0.045455
canada0.033333
soil0.029703
LOWER IN sediment0.029412
sediment0.029412
farm0.027027
depth (soil) 0-20cm0.024390
united states of america0.015444
china0.010811
LOWER IN soil0.009901
LOWER IN control0.005263
control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
root0.844156
united states of america0.324675
rhizosphere0.233766
root endosphere0.220779
state of california0.181818
LOWER IN root0.155844
plant0.142857
citrus0.129870
state of florida0.129870
canada0.129870
farm0.129870
cannabis sativa0.129870
brazil0.129870
marine eelgrass0.103896
zostera marina0.103896
ocean0.103896
cultivated environment0.103896
brassicaceae0.103896
boechera stricta0.103896
state of idaho0.103896
LOWER IN rhizosphere0.090909
china0.090909
soil0.077922
bodega bay0.077922
minas gerais state0.077922
campos rupestres0.077922
state of tennessee0.077922
populus0.077922
tree0.077922
agave0.077922
desert0.077922
oryza sativa0.077922
rice0.077922
mexico0.064935
state of new york0.064935
merlot0.064935
vitis vinifera0.064935
grapevine0.064935
triticum aestivum0.051948
wheat0.051948
vellozia epidendroides0.051948
guanajuato0.051948
saccharum0.051948
sugarcane0.051948
campinas0.051948
greenhouse0.051948
depth (soil) 0-20cm0.038961
glycine max0.038961
soybean0.038961
endosphere0.038961
quincy, fl0.025974
immokalee, fl0.025974
gainesville, fl0.025974
root structure0.025974
seedling0.025974
propagation stage0.025974
pre-vegetative stage0.025974
early flowering stage0.025974
late flowering stage0.025974
rhizome0.025974
leaf0.025974
LOWER IN leaf0.025974
barbacenia macrantha0.025974
agave deserti0.025974
agave salmiana0.025974
agave tequiliana0.025974
vero beach, fl0.025974
pierce, fl0.012987
LOWER IN soil0.012987
LOWER IN root structure0.012987
root nodule0.012987
myrtillocactus geometrizans0.012987
opuntia robusta0.012987
cactus0.012987
semi-arid0.012987
root interior0.012987
LOWER IN root endosphere0.012987
LOWER IN sediment0.012987
LOWER IN marine sediment0.012987
sediment0.012987
marine sediment0.012987
LOWER IN bulk soil0.012987
bulk soil0.012987
populus deltoides0.012987
LOWER IN populus trichocarpa x deltoides0.012987
populus trichocarpa x deltoides0.012987
LOWER IN populus deltoides0.012987
drought environment0.012987
LOWER IN control0.012987
control0.012987
LOWER IN drought environment0.012987
LOWER IN endosphere0.012987
ft. pierce, fl0.012987
Exp. ID User ID Description Date Region Flag Sequences
101amnondominant state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
171amnondominant united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 2
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 6
615amnondominant endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 6
266amnonhigh freq. in roots in SIL garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 6
98amnondominant citrus, rhizosphere, pierce, fl, state of florida, root2017-04-01v4No1 / 7
98amnondominant citrus, rhizosphere, quincy, fl, state of florida, root2017-04-01v4No1 / 8
236amnondominant state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 8
98amnondominant citrus, rhizosphere, immokalee, fl, state of florida, root2017-04-01v4No1 / 9
98amnondominant citrus, rhizosphere, gainesville, fl, state of florida, root2017-04-01v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 9
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
235amnonhigh freq. in eelgrass roots (dominant ocean, rhizome, zostera marina, marine eelgrass, root)2017-11-07v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
266amnonhigh freq. in roots in MAH garden (dominant brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 12
618amnondominant pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 13
360amnondominant agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 13
360amnondominant agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 13
98amnondominant citrus, rhizosphere, vero beach, fl, state of florida, root2017-04-01v4No1 / 13
618amnondominant late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 15
360amnondominant agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 17
271amnoncommon depth (soil) 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
618amnondominant canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 21
618amnondominant early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 24
129amnonfound INSIDE roots of cactus (common mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, root interior, root)2017-04-15v4No1 / 29
618amnoncommon canada, farm, seedling, propagation stage, root, root endosphere, cannabis sativa2020-05-04v4No1 / 44
462amnoncommon united states of america, state of tennessee, populus, tree, root, cultivated environment2019-01-13v4No1 / 51
360amnoncommon agave, desert, root endosphere, agave deserti, state of california, root2018-08-21v4No1 / 52
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
360amnoncommon agave, desert, root endosphere, mexico, guanajuato, agave tequiliana, cultivated environment, root2018-08-21v4No1 / 62
360amnoncommon agave, desert, root endosphere, agave salmiana, mexico, guanajuato, root2018-08-21v4No1 / 87
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
235amnoncommon in eelgrass roots (common marine eelgrass, zostera marina, ocean, rhizome, root)2017-11-07v4No1 / 116
171amnoncommon united states of america, state of california, oryza sativa, rice, root2017-07-25v4No1 / 156
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
618amnoncommon early flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 205
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 213
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 254
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 282
236amnon high in leaf compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 287
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america state of california oryza sativa rice root )2017-07-25v4No1 / 288
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree root cultivated environment 2019-01-13v4No1 / 300
618amnoncommon pre-vegetative stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 318
618amnoncommon late flowering stage, canada, farm, root, root endosphere, cannabis sativa2020-05-04v4No1 / 352
236amnoncommon state of california, bodega bay, ocean, zostera marina, marine eelgrass, root2017-11-07v4No1 / 483
618amnon high in root endosphere root compared to rhizosphere in canada farm cannabis sativa 2020-05-04v4No1 / 510
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
98amnoncommon citrus, rhizosphere, immokalee, fl, root, state of florida2017-04-01v4No1 / 543
98amnoncommon citrus, rhizosphere, vero beach, fl, root, state of florida2017-04-01v4No1 / 544
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
236amnon high in root compared to sediment marine sediment in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 674
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
236amnon high in root compared to leaf in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 819
266amnoncommon in roots in JAM garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 843
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
98amnoncommon citrus, rhizosphere, quincy, fl, root, state of florida2017-04-01v4No1 / 950
101amnoncommon state of new york, merlot, vitis vinifera, grapevine, united states of america, root2017-04-03v4No1 / 1106
266amnoncommon in roots in MAH garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1110
266amnon high in leaf compared to root in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 1175
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1315
98amnoncommon citrus, rhizosphere, ft. pierce, fl, root, state of florida2017-04-01v4No1 / 1340
98amnoncommon citrus, rhizosphere, gainesville, fl, root, state of florida2017-04-01v4No1 / 1371
266amnoncoomon in roots in SIL garden (common brassicaceae, boechera stricta, plant, united states of america, state of idaho, root)2017-12-19v4No1 / 1399
101amnon high in rhizosphere compared to root in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 1588
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
101amnon high in root compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 2075
236amnon high in sediment marine sediment compared to root in state of california bodega bay ocean zostera marina marine eelgrass 2017-11-07v4No1 / 2745
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
618amnon high in rhizosphere compared to root endosphere root in canada farm cannabis sativa 2020-05-04v4No1 / 3134
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in brassicaceae boechera stricta plant united states of america state of idaho 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org