Summary for ontology term: rumen

Number of annotations with term: 121

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTAGGGAGTTTTCGGCAATGGGGGAAACCCTGACCGAGCAACACCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAGCTCTGTTACGAGGGACGAATGATCGCTTTAGGAAATGAGAGCGGTTTGACGGTACCTCGCCAGAAAGCGACGGC0.043478
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATACAGGGATAAAGTCAGTTACGTGTAACTGTTTGTAGGTACTGTATGAATAAGGACCGGCTAATT0.043478
d__BacteriaTAAGGAGTTTTCGGCAATGGGGGAAACCCTGACCGAGCAACGCCGCGTGAGCGATGACGGCCCTATGGGTTGTAAAGCTCTGTTGTAAGCCATGAATGACAGCTTGAGGAAATGCAAGTTGTTTGACGACAGCTTACCAGAAAGCCACGG0.043478
d__BacteriaTCGGGAATATTGCACAATGGAGGAAACTCTGATGCAGTGACGCCGCGTACAGGAAGAAGGTCTTTGGATTGTAAACTGTTGTCGAAAGGGAAGAAAAAGGACAGTACCTTTGGAGGAAGCTCCGGCAAACTACGTGCCAGCAGCCGCGGT0.043478
d__Bacteria;p__Firmicutes;c__Negativicutes;o__SelenomonadalesTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAGGAAGTTCTTCGGAACGTAAAGCTCTGTTGTTCCTGACGAACCTCCCCTCTATCAACAACGGAGGGGATTGACGGTAGGGAACGAGGAAGCCACGG0.043478
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGCGTGGATGATGAAGGCCGGAAGGTTGTAAAATCCTTTTAGGTGCGAGGAATAAGTGTGGTGAGAGAAACGCCATATGGTGACGGTAGCACCTGAATAAGCAACGG0.043478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACGGTACCTGACTAAGAAGCACCGGCTAAATACGTGCCAGCAGCCGCGGTA0.043478
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGAAGGTTCTATGGATTGTAAACTTCTTTTGTCCGAGGGTAAAAAAGGCCACGTGTGGCTTCTTGCAAGTATCGGACGAATAAGCATCGGCTAACT0.043478
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGCAGGACGACTGCCCTATGGGTTGTAAACTGCTTTTATCAGGGAATAAAGTGCGGCACGTGTGCCGTTTTGTATGTACCTGATGAATAAGGACCGGCTAATT0.043478
d__Bacteria;p__Firmicutes;c__Negativicutes;o__SelenomonadalesTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAGGAAGTTCTTCGGAACGTAAAGCTCTGTTGTTCCTGACGAACCTCCCCTCTATCAACAACGGAGGGGACTGACGGTAGGGAACGAGGAAGCCACGG0.043478

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCCTCAAGGAAGATAATGACGGTACTTGAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTAGGGAATCTTCGGCAATGGGCGAAAGCCTGACCGAGCAACGCCGCGTGAATGATGAAGGCCTTCGGGTTGTAAAATTCTGTTATAAGGGAAGAACGACTTTAGTAGGAAATGGCTAAAGTGTGACGGTACCTTATGAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGAGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAAGGATGAAGGCCCTTGGGTCGTAAACTTCTGTTCTAAGGGAAGATAATGACGGTACCTTAGGAGCAAGTCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__BacteriaTGGGGGATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGCGGGAAGACGGCCTTCGGGTTGTAAACCGCTGTCCTTGGGGAAGAAACAAATGACGGTACCCAAGAAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGGGCAATGGGGGAAACCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGCCTTCGGGTTGTAAACTTCTTTTACCAGGGACGAAGAACGTGACGGTACCTGGAGAAAAAGCAACGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGCGAAGAAGGCCTTCGGGTCGTAAAGCTCTGTTGTCAGGGAAGAACAAGTGCCATTCGAATAGGTTGGCACCTTGACGGTACCTGGCCAGAAAGCCACGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.375000
d__BacteriaTAAGGAATCTTGCACAATGGGGGAAACCCTGATGCAGCAACGCCGCGTGAACGATGAAGGCCTTAGGGTTGTAAAGTTCTGATCTGGGGGAAGAAGAAAGTGACGGTACCCCAGGAGAAAGCCCCGGCTAAATACGTGCCAGCAGCCGCG0.375000
d__BacteriaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAACGAAGAAGGCTCTTGGGTCGTAAAGTTCTGTTCTGAGGGAAGAAGATCTGACGGTACCTCAGGAGAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGG0.375000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGATGATTAAGCGTGACGTGAAATGTAGCCGCTCAACGGCTGAACTGCGTCGCGAACTGGTTATCTTGAGTGAGTTCGATGTTGGCGGAATTCGTGG0.373333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGATGTGAAATCTATGGGCTTAACTCATAAACTGCATTTGAAACTGTATCTCTTGAGTGCTGGAGAGGTAGACGGAATTCCTTG0.344371
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGAAGGTTCTATGGATTGTAAACTTCTTTTGTCCGAGGGTAAAAAAGGCCACGTGTGGCTTCTTGCAAGTATCGGACGAATAAGCATCGGCTAACT0.335570
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTAAGTGGAATTCCCAG0.329114
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGATTATTAAGCGTGACGTGAAATGTAGATGCTCAACATCTGAACTGCGTCGCGAACTGGTAGTCTTGAGTGAGTTCGATGTGGGCGGAATTCGTGG0.322148
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGGATTTTAAGCGTGTTGTGAAATGTACCGGCTCAACCGGTGATGTGCAGCGCGAACTGGAGTCCTTGAGTGAGTACGACGTCAGCGGAATTCGTGG0.312057
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__ButyrivibrioTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAGGCTCGTAAGAGAGATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGC0.312057
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGGAGGTCAAGCGTGACGTGAAATGTAGCCGCTCAACGGCTGAACTGCGTCGCGAACTGGCTTTCTTGAGTGAGTTCGATGTGGGCGGAATTCGTGG0.306667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATACGGGGATAAAGTGAGGGACGTGTCCCTTTTTGTAGGTACCGTATGAATAAGGACCGGCTAATT0.305556
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGGATGACTTGAGTACGCGGGAAGCAGGCGGAATTCGTCG0.303448

Annotations:

common ontology terms
term enrichment score
TermScore
rumen0.981022
ruminal fluid0.468354
ovis aries0.415869
rumen liquid0.364865
bos taurus0.352485
sheep0.340909
bos grunniens0.262522
yak0.236659
capra hircus0.209059
goat0.209059
cow0.162476
holstein dairy cow0.162162
ireland0.158940
shandong province0.146597
female organism0.127854
research facility0.120352
alpine meadow0.116788
state of mississippi0.116788
lamb0.116788
dairy goat0.116788
holstein-friesian bull0.116788
LOWER IN rumen0.115756
western australia0.110345
china0.105994
shanxi province0.104575
age 1 year0.099379
tibetan plateau0.094675
gauteng province0.094488
riwoqe county0.094488
ruminant reticulum0.090226
omasum0.090226
age 7 months0.090226
siberia0.086331
reindeer0.086331
rangifer tarandus0.086331
tibet autonomous region0.082759
nanjing city prefecture0.082759
digesta0.073620
diet0.070381
russia0.064171
abomasum0.062992
restricted feed0.062992
dairy0.062016
chinese bohai black beef cattle0.062016
chinese luxi yellow beef cattle0.062016
mongolian sheep0.062016
age 100 days0.062016
camel0.062016
camelus dromedarius0.062016
pregnancy0.060302
age 30 days0.060150
age < 1 year0.060150
age 140 days0.060150
calve0.060150
state of nebraska0.058394
juvenile stage0.058394
south africa0.056872
tundra0.056738
farm0.055888
LOWER IN colon0.055556
colon0.055556
egypt0.055172
qinghai province0.050955
obsolete_juvenile stage0.049689
LOWER IN caecum0.049080
caecum0.049080
damara sheep0.048387
meatmaster sheep0.048387
LOWER IN ruminant reticulum0.048000
LOWER IN omasum0.048000
australia0.047478
jersey cow0.047244
chinese laoshan milk goat0.047244
subacute rumen acidosis0.047244
acidosis0.047244
LOWER IN abomasum0.046154
LOWER IN ruminal fluid0.045627
LOWER IN ileum0.043165
ileum0.043165
winter0.040134
LOWER IN winter0.040134
age0.039344
italy0.038278
LOWER IN summer0.038217
summer0.038217
germany0.032129
green stage diet0.032000
LOWER IN grass growth diet0.032000
grass growth diet0.032000
LOWER IN green stage diet0.032000
withered grass diet0.032000
LOWER IN withered grass diet0.032000
LOWER IN chinese luxi yellow beef cattle0.032000
LOWER IN chinese bohai black beef cattle0.032000
age 2 years0.032000
hainan black goat0.032000
creole goat0.032000
LOWER IN jejunum0.031250
jejunum0.031250
municipality of beijing0.031008
Fraction of dbbact annotations with this term covered by the query
TermScore
rumen1.043478
ruminal fluid1.000000
rumen liquid1.000000
damara sheep1.000000
gauteng province1.000000
meatmaster sheep1.000000
LOWER IN damara sheep1.000000
LOWER IN meatmaster sheep1.000000
riwoqe county1.000000
bos grunniens0.800000
yak0.750000
LOWER IN ruminant reticulum0.750000
LOWER IN omasum0.750000
holstein dairy cow0.750000
abomasum0.666667
capra hircus0.666667
goat0.666667
restricted feed0.666667
ovis aries0.615385
sheep0.545455
dairy0.500000
ruminant reticulum0.500000
omasum0.500000
alpine meadow0.500000
green stage diet0.500000
LOWER IN grass growth diet0.500000
grass growth diet0.500000
LOWER IN green stage diet0.500000
withered grass diet0.500000
LOWER IN withered grass diet0.500000
LOWER IN jersey cow0.500000
state of mississippi0.500000
jersey cow0.500000
lamb0.500000
LOWER IN woodland0.500000
LOWER IN yamalo-nenets autonomous okrug0.500000
woodland0.500000
yamalo-nenets autonomous okrug0.500000
chinese bohai black beef cattle0.500000
chinese laoshan milk goat0.500000
chinese luxi yellow beef cattle0.500000
LOWER IN high milk yield0.500000
low milk yield0.500000
LOWER IN low milk yield0.500000
high milk yield0.500000
LOWER IN chinese luxi yellow beef cattle0.500000
LOWER IN chinese bohai black beef cattle0.500000
LOWER IN chinese laoshan milk goat0.500000
LOWER IN acidosis0.500000
LOWER IN subacute rumen acidosis0.500000
dairy goat0.500000
subacute rumen acidosis0.500000
acidosis0.500000
LOWER IN 5-6 hours0.500000
1-2 hours0.500000
5-6 hours0.500000
LOWER IN 1-2 hours0.500000
age 7 months0.500000
mongolian sheep0.500000
age 100 days0.500000
linseed oil food product0.500000
LOWER IN linseed oil food product0.500000
holstein-friesian bull0.500000
LOWER IN normal feed0.500000
LOWER IN restricted diet0.500000
660 days0.500000
LOWER IN 605 days0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN rumen solids0.500000
rumen solids0.500000
age 2 years0.500000
corn diet0.500000
40mdgs diet0.500000
LOWER IN 27cds diet0.500000
LOWER IN 55cs diet0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
fresh clover diet0.500000
LOWER IN clover hay diet0.500000
hainan black goat0.500000
creole goat0.500000
ireland0.400000
bos taurus0.388889
age 30 days0.333333
age < 1 year0.333333
LOWER IN younger age0.333333
older age0.333333
LOWER IN older age0.333333
younger age0.333333
siberia0.333333
reindeer0.333333
rangifer tarandus0.333333
nenets autonomous okrug0.333333
Fraction of annotations for the query sequences containing the term
TermScore
rumen0.925620
research facility0.528926
china0.487603
bos taurus0.322314
ovis aries0.314050
ruminal fluid0.305785
sheep0.247934
rumen liquid0.223140
bos grunniens0.157025
yak0.140496
capra hircus0.123967
goat0.123967
female organism0.115702
cow0.115702
shandong province0.115702
united states of america0.099174
ireland0.099174
holstein dairy cow0.090909
LOWER IN rumen0.074380
tibetan plateau0.066116
alpine meadow0.066116
state of mississippi0.066116
lamb0.066116
dairy goat0.066116
shanxi province0.066116
holstein-friesian bull0.066116
western australia0.066116
age 1 year0.066116
australia0.066116
farm0.057851
control0.057851
ruminant reticulum0.049587
omasum0.049587
siberia0.049587
russia0.049587
reindeer0.049587
rangifer tarandus0.049587
age 7 months0.049587
gauteng province0.049587
south africa0.049587
riwoqe county0.049587
tibet autonomous region0.049587
diet0.049587
nanjing city prefecture0.049587
pregnancy0.049587
digesta0.049587
female0.049587
age 30 days0.033058
obsolete_juvenile stage0.033058
italy0.033058
dairy0.033058
LOWER IN caecum0.033058
LOWER IN colon0.033058
caecum0.033058
colon0.033058
abomasum0.033058
qinghai province0.033058
age < 1 year0.033058
tundra0.033058
chinese bohai black beef cattle0.033058
chinese luxi yellow beef cattle0.033058
mongolian sheep0.033058
child0.033058
age 100 days0.033058
restricted feed0.033058
state of nebraska0.033058
egypt0.033058
camel0.033058
camelus dromedarius0.033058
adult0.033058
germany0.033058
juvenile stage0.033058
age 140 days0.033058
calve0.033058
LOWER IN summer0.024793
LOWER IN ruminant reticulum0.024793
LOWER IN omasum0.024793
summer0.024793
winter0.024793
LOWER IN winter0.024793
jersey cow0.024793
LOWER IN feces0.024793
LOWER IN ruminal fluid0.024793
feces0.024793
age0.024793
chinese laoshan milk goat0.024793
LOWER IN control0.024793
subacute rumen acidosis0.024793
acidosis0.024793
damara sheep0.024793
meatmaster sheep0.024793
LOWER IN ileum0.024793
ileum0.024793
LOWER IN abomasum0.024793
LOWER IN rectum0.016529
spring0.016529
green stage diet0.016529
LOWER IN grass growth diet0.016529
rectum0.016529
LOWER IN spring0.016529
Exp. ID User ID Description Date Region Flag Sequences
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 1
439amnonpresent only in abomasum in yak rumen ( high in abomasum compared to omasum ruminant reticulum in bos grunniens yak rumen farm china )2018-12-31v4No1 / 2
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 3
931amnondominant riwoqe county, china, ruminal fluid, yak, tibet autonomous region, bos grunniens, rumen2022-08-25v3No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 4
329amnondominant ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 4
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, rumen, research facility2022-05-18v3No1 / 5
929amnondominant damara sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 6
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, rumen, juvenile stage, research facility2022-05-20v1No1 / 6
551amnondominant egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 7
889amnondominant reindeer, rangifer tarandus, ruminal fluid, siberia, russia, rumen2022-04-01v3No1 / 8
687amnondominant shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 8
929amnondominant meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 8
701amnondominant municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 8
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
687amnondominant chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 9
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 11
657amnondominant research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 12
27amnondominant bos grunniens, rumen, china2016-12-05v4No1 / 12
82amnonhigh freq. in dairy cow rumen fluid (dominant bos taurus, sweden, rumen)2017-03-05v4No1 / 12
748amnondominant jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 14
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
687amnondominant chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 16
491amnondominant ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 16
83amnondominant bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 16
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 18
561amnon high in winter withered grass diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 18
111amnondominant rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 18
739amnondominant age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 18
261amnondominant bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 19
439amnondominant bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 20
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 34
561amnon high in spring green stage diet compared to withered grass diet winter in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 35
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
83amnonhigher in rumen liquids compared to solids in normal diet cows ( high in rumen liquid compared to rumen solids in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 40
439amnoncommon bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 52
657amnonpostively correlated with age ( high in older age age compared to younger age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 65
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
905amnon high in abomasum compared to rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 78
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 80
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 83
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v3No1 / 96
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
889amnon high in woodland yamalo-nenets autonomous okrug compared to nenets autonomous okrug in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 151
889amnon high in winter compared to summer in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 205
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
929amnon high in meatmaster sheep compared to damara sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 231
889amnon high in nenets autonomous okrug compared to woodland yamalo-nenets autonomous okrug in tundra reindeer rangifer tarandus ruminal fluid siberia russia rumen 2022-04-01v3No1 / 247
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 248
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
561amnon high in grass growth diet summer compared to spring green stage diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
905amnon high in rumen compared to abomasum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 264
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
111amnon high in rumen ruminant reticulum omasum compared to rectum ileum caecum colon in mongolian sheep ovis aries china 2017-04-09v4No1 / 294
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
687amnon high in chinese laoshan milk goat goat capra hircus compared to chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 318
561amnon high in winter withered grass diet compared to grass growth diet summer in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 357
363amnon high in rumen ruminant reticulum omasum compared to caecum colon rectum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 360
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
739amnoncommon age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 392
561amnon high in spring green stage diet compared to summer grass growth diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 397
687amnoncommon chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 429
929amnoncommon meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 432
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
889amnoncommon siberia, russia, reindeer, rangifer tarandus, rumen, ruminal fluid2022-04-01v3No1 / 469
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 504
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
910amnoncommon rumen, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 510
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
905amnoncommon rumen, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 597
748amnon high in jersey cow compared to holstein dairy cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 603
748amnoncommon holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 614
931amnon high in jejunum duodenum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 622
931amnoncommon ruminal fluid, rumen, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 626
748amnoncommon jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 632
748amnon high in holstein dairy cow compared to jersey cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 638
889amnon high in summer compared to winter in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 647
929amnon high in damara sheep compared to meatmaster sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 648
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
929amnoncommon age 7 months, damara sheep, gauteng province, south africa, research facility, rumen, rumen liquid, sheep, ovis aries2022-08-16v3No1 / 706
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
687amnon high in chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus compared to chinese laoshan milk goat goat capra hircus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 1022
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
687amnoncommon chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1039
687amnoncommon shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1147
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v1No1 / 1194
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1322
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735
910amnon high in rumen compared to mouth mucosa oral cavity in age 140 days holstein dairy cow calve germany bos taurus juvenile stage research facility 2022-05-20v1No1 / 1744
931amnon high in ileum feces colon caecum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 1870
905amnon high in abomasum rumen compared to jejunum ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 2033
931amnon high in ruminal fluid rumen compared to jejunum duodenum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2088
905amnon high in feces caecum colon compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2270
748amnon high in feces compared to ruminal fluid rumen in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2467
931amnon high in ruminal fluid rumen compared to ileum feces colon caecum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2519
748amnon high in ruminal fluid rumen compared to feces in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2716
905amnon high in abomasum rumen compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org