Summary for ontology term: rural community

Number of annotations with term: 70

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.061538
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAGTAAGTCAGTCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATTGAAACTACTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.061538
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCGGGGCACTGCAGCGCGAACTGGCAGACTTGAGTGCACGGTAGGAAGGCGGAATTCGTCG0.061538
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCATGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAGCCTGCTTTCAAAACTGCGTGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.061538
d__BacteriaTACGTAGGTGACAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTCCGCAGGTGGTTTGATAAGTCTGACGTGAAATACCGGAGCTCAACTCCGGAACTGCGTTGGAGACTGTTGAACTGGAGTATCGGAGAGGAAATTGGAATTCCAGG0.061538
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGACTTTAAGTCAGCTGTGAAATTTTCCGGCTCAACCGGGAAACTGCAGTTGATACTGGCGTCCTTGAGTACGGTCGAGGCAGGCGGAATTCGTGG0.061538
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTAGGCTAAGCGTGCCGTGAAATACCGTCGCTCAACGGCGGCCGTGCGGCGCGAACTGGTCTACTTGAGTACGCGGGACGTTGGCGGAATTCGTGG0.061538
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCGAATTAAGTCAGCGGTGAAAGACCGGGGCTCAACCCTGGAAGTGCCGTTGATACTGATTGGCTAGAATACCCTTGCCGTGGGAGGAATGAGTGG0.061538
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCCCTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGGGGGCTTGAGTGCACGCAACGCAGGCGGAATTCGTGG0.061538
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTACGTCAGAGGGGGGTGGAATTCCGCG0.061538

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.714286
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATACCGGGGCTCAACTCCGGAACTGCCTCTAATACTGTTGAACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTCATCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.571429
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.571429

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACCTTTAAGTCAGCTGTGAAATACGGCGGCTCAACCGTCGAACTGCAGTTGATACTGGAGGTCTTGAGTGCACACAGGGATACTGGAATTCATGG0.309859
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCATAAAGTGGGCGGAATTCGTGG0.300000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGAGGCTCAACCTCTGCACTGCAGCGCGAACTGGTCTTCTTGAGTACGCACAACGTGGGCGGAATTCGTGG0.299401
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTCATCAAGTAGGATGTGAAATCCCCGGGCTCAACCTGGGAACAGCATACTAAACTGGTGGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.288372
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGGGTATTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACCGCAGCGCGAACTGGTGCCCTTGAGTACGCACGACGTTGGCGGAATTCGCCG0.280992
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__SpirochaetaceaeCACGTAAGGCGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCGTGTAGGCGGCCCTGCAAGCCTGGCGTGAAATCCCGGGGCCCAACCCCGGAACCGCGCTGGGAACTGCTGGGCTTGAGCCGCTGTGGCGCAGCCGGAATTCCAGG0.272727
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCGGGGCACTGCAGCGCGAACTGGCAGACTTGAGTGCACGGTAGGAAGGCGGAATTCGTCG0.270270
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGGGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGTCCGACTGGAGTACGTCAGAGGGGGGTGGAATTCCGCG0.269841
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGAGAGGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.263158
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCGAATTAAGTCAGCGGTGAAAGACCGGGGCTCAACCCTGGAAGTGCCGTTGATACTGATTGGCTAGAATACCCTTGCCGTGGGAGGAATGAGTGG0.255639

Annotations:

common ontology terms
term enrichment score
TermScore
rural community0.986301
chuquisaca department0.255319
himalayas0.239130
age 5-13 years0.226415
nepal0.213592
village0.205128
bolivia0.203390
LOWER IN rural community0.172840
small village0.146341
kebbi state0.146341
10-15-years-old human0.136364
tanzania0.127660
city0.120000
nigeria0.120000
thailand0.117647
urban community0.108108
botswana0.108108
shuar population0.102564
forearm0.102564
cameroon0.097561
human middle aged stage0.097561
arm0.097561
child0.091371
LOWER IN city0.088889
homo sapiens0.084806
schistosomiasis0.082192
urinary schistosomiasis0.082192
ecuador0.081633
tunapuco0.078947
ngoantet0.078947
tharu0.078947
agrarian0.078947
chepang0.078947
bushbuckridge local municipality0.078947
peri-urban community0.078947
soweto0.078947
south africa0.077922
forager0.075949
mouth mucosa0.075472
feces0.073272
human adult stage0.068966
peru0.068182
adult0.064473
commonwealth of pennsylvania0.061856
LOWER IN urban community0.055556
LOWER IN botswana0.055556
saen thong subdistrict0.055556
LOWER IN small village0.054054
republic of congo0.054054
nouabale-ndoki national park0.054054
raji0.054054
raute0.054054
LOWER IN forearm0.054054
LOWER IN arm0.052632
LOWER IN tanzania0.051282
mouth0.048193
LOWER IN mouth mucosa0.045455
human late adulthood stage0.044444
africa0.042781
skin0.039604
LOWER IN mouth0.033898
LOWER IN skin0.029412
LOWER IN schistosomiasis0.028169
LOWER IN urinary schistosomiasis0.028169
LOWER IN tunapuco0.027778
LOWER IN yaounde0.027778
yaounde0.027778
LOWER IN ngoantet0.027778
hmong0.027778
LOWER IN myanmar0.027778
LOWER IN karen0.027778
myanmar0.027778
karen0.027778
LOWER IN hmong0.027778
cross-cutucu0.027778
LOWER IN upano valley0.027778
upano valley0.027778
LOWER IN cross-cutucu0.027778
LOWER IN himalayas0.027778
LOWER IN chepang0.027778
LOWER IN tharu0.027778
LOWER IN agrarian0.027778
LOWER IN soweto0.027778
LOWER IN bushbuckridge local municipality0.027778
LOWER IN peri-urban community0.027778
hadza0.027778
LOWER IN hadza0.027778
state of oklahoma0.027397
LOWER IN state of oklahoma0.027397
LOWER IN nepal0.027397
LOWER IN forager0.027397
hunter gatherer0.027027
LOWER IN hunter gatherer0.027027
female0.026786
LOWER IN peru0.026316
LOWER IN thailand0.026316
LOWER IN commonwealth of pennsylvania0.025316
united states of america0.025237
LOWER IN united states of america0.025237
china0.020000
Fraction of dbbact annotations with this term covered by the query
TermScore
rural community1.090909
village1.000000
schistosomiasis1.000000
urinary schistosomiasis1.000000
LOWER IN schistosomiasis1.000000
LOWER IN urinary schistosomiasis1.000000
LOWER IN urban community1.000000
urban community1.000000
LOWER IN botswana1.000000
botswana1.000000
saen thong subdistrict1.000000
LOWER IN rural community0.636364
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
small village0.500000
tunapuco0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
ngoantet0.500000
LOWER IN yaounde0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
myanmar0.500000
karen0.500000
LOWER IN hmong0.500000
cross-cutucu0.500000
LOWER IN upano valley0.500000
shuar population0.500000
upano valley0.500000
LOWER IN cross-cutucu0.500000
LOWER IN himalayas0.500000
himalayas0.500000
tharu0.500000
agrarian0.500000
LOWER IN chepang0.500000
chepang0.500000
LOWER IN tharu0.500000
LOWER IN agrarian0.500000
raji0.500000
raute0.500000
kebbi state0.500000
bushbuckridge local municipality0.500000
peri-urban community0.500000
LOWER IN soweto0.500000
soweto0.500000
LOWER IN bushbuckridge local municipality0.500000
LOWER IN peri-urban community0.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN forearm0.500000
hadza0.500000
LOWER IN hadza0.500000
state of oklahoma0.333333
LOWER IN state of oklahoma0.333333
cameroon0.333333
thailand0.333333
LOWER IN nepal0.333333
nepal0.333333
LOWER IN forager0.333333
forager0.333333
10-15-years-old human0.333333
human middle aged stage0.333333
age 5-13 years0.333333
arm0.333333
LOWER IN arm0.333333
bolivia0.250000
LOWER IN tanzania0.250000
tanzania0.250000
hunter gatherer0.250000
LOWER IN hunter gatherer0.250000
city0.200000
LOWER IN city0.200000
nigeria0.200000
LOWER IN peru0.166667
peru0.166667
LOWER IN thailand0.166667
ecuador0.142857
mouth mucosa0.111111
LOWER IN mouth mucosa0.111111
commonwealth of pennsylvania0.111111
LOWER IN commonwealth of pennsylvania0.111111
human late adulthood stage0.100000
south africa0.071429
child0.055556
human adult stage0.045455
homo sapiens0.044280
mouth0.041667
LOWER IN mouth0.041667
feces0.038217
adult0.034682
skin0.030303
LOWER IN skin0.030303
LOWER IN africa0.026316
africa0.026316
united states of america0.016194
LOWER IN united states of america0.016194
female0.015873
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
rural community0.900000
feces0.885714
adult0.457143
child0.257143
bolivia0.171429
chuquisaca department0.171429
age 5-13 years0.171429
nepal0.157143
himalayas0.157143
human adult stage0.142857
village0.114286
africa0.114286
LOWER IN rural community0.100000
city0.085714
small village0.085714
nigeria0.085714
kebbi state0.085714
10-15-years-old human0.085714
female0.085714
south africa0.085714
tanzania0.085714
thailand0.071429
china0.071429
united states of america0.057143
LOWER IN united states of america0.057143
LOWER IN city0.057143
cameroon0.057143
ecuador0.057143
shuar population0.057143
human middle aged stage0.057143
urban community0.057143
mouth mucosa0.057143
mouth0.057143
arm0.057143
skin0.057143
forearm0.057143
botswana0.057143
peru0.042857
tunapuco0.042857
ngoantet0.042857
tharu0.042857
agrarian0.042857
forager0.042857
chepang0.042857
schistosomiasis0.042857
urinary schistosomiasis0.042857
control0.042857
bushbuckridge local municipality0.042857
peri-urban community0.042857
soweto0.042857
commonwealth of pennsylvania0.042857
LOWER IN small village0.028571
republic of congo0.028571
nouabale-ndoki national park0.028571
raji0.028571
raute0.028571
LOWER IN urban community0.028571
LOWER IN feces0.028571
LOWER IN mouth mucosa0.028571
LOWER IN mouth0.028571
LOWER IN arm0.028571
LOWER IN skin0.028571
LOWER IN forearm0.028571
LOWER IN tanzania0.028571
LOWER IN botswana0.028571
saen thong subdistrict0.028571
human late adulthood stage0.028571
state of oklahoma0.014286
LOWER IN peru0.014286
LOWER IN tunapuco0.014286
LOWER IN state of oklahoma0.014286
LOWER IN yaounde0.014286
yaounde0.014286
LOWER IN ngoantet0.014286
LOWER IN thailand0.014286
hmong0.014286
LOWER IN myanmar0.014286
LOWER IN karen0.014286
myanmar0.014286
karen0.014286
LOWER IN hmong0.014286
LOWER IN china0.014286
cross-cutucu0.014286
LOWER IN upano valley0.014286
upano valley0.014286
LOWER IN cross-cutucu0.014286
LOWER IN nepal0.014286
LOWER IN himalayas0.014286
LOWER IN forager0.014286
LOWER IN chepang0.014286
LOWER IN tharu0.014286
LOWER IN agrarian0.014286
LOWER IN control0.014286
LOWER IN schistosomiasis0.014286
LOWER IN urinary schistosomiasis0.014286
LOWER IN soweto0.014286
LOWER IN bushbuckridge local municipality0.014286
LOWER IN peri-urban community0.014286
LOWER IN africa0.014286
Exp. ID User ID Description Date Region Flag Sequences
594amnondominant feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 8
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 8
861amnondominant feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 11
620amnondominant feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 13
861amnondominant feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
477amnondominant feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
873amnondominant feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 14
517amnondominant feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 15
873amnondominant feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 15
660amnondominant feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 17
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
477amnondominant feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 18
875amnondominant feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 18
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
477amnondominant feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 19
477amnondominant feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 20
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 34
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 35
873amnon high in hunter gatherer hadza compared to maasai sandawe burunge in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 37
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
873amnon high in maasai sandawe burunge compared to hunter gatherer hadza in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 46
875amnoncommon feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 65
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in forager chepang compared to tharu agrarian in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 73
861amnoncommon feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 73
873amnon high in tanzania rural community botswana compared to united states of america commonwealth of pennsylvania urban community in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 73
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
477amnoncommon feces, homo sapiens, nepal, himalayas, rural community, raute2019-01-29v4No1 / 76
873amnoncommon feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 81
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 88
477amnoncommon feces, homo sapiens, raji, nepal, himalayas, rural community2019-01-29v4No1 / 88
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
861amnoncommon feces, homo sapiens, female, south africa, rural community, bushbuckridge local municipality, human middle aged stage, peri-urban community2022-01-15v3No1 / 113
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
660amnoncommon feces, homo sapiens, ecuador, rural community, village, shuar population2020-09-20v4No1 / 123
873amnoncommon feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 125
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in feces homo sapiens ecuador rural community village shuar population )2020-09-20v4No1 / 132
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
861amnon high in city soweto urban community compared to rural community bushbuckridge local municipality peri-urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 185
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
873amnon high in botswana compared to tanzania in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 226
873amnon high in united states of america commonwealth of pennsylvania urban community compared to tanzania africa rural community botswana in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 227
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
861amnon high in rural community bushbuckridge local municipality peri-urban community compared to city soweto urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 289
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
873amnon high in tanzania compared to botswana in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 333
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org