Summary for ontology term: russia

Number of annotations with term: 44

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAAACTTCCGGCTCAACCGGGGGCTTGCGGTGGGTACGGGCCGGCTAGAGTGCGGTAGGGGTAACTGGAACTCCTGG0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGTTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.042553
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.042553
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.042553
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.042553
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.042553

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGATTGATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGAAGAACTGCATCAGAAACTGTCAATCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAGAATAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGAGGGTGCAAGCGTTATTCGGATTTATTGGGCGTAAAGGGCGCGTAGGCGGTCTCTTAAGTCAGATGTGAAAGCCCGGGGCTTAACCTCGGAAGTGCATTTGAAACTAAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.181818
d__Bacteria;p__FirmicutesTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAGGAAGTTCTTCGGAACGTAAAGCTCTGTTGTTCCCGACGAACGGGTTTCCTGTGAAGAATGGGGAGCAGTGACGGTAGGGGACGAGAAAGCCACGG0.153846
d__BacteriaGACGGAGGGGGCGAGCGTTGTTCGGATTTACTGGGCGTAAAGAGCACGTAGGCGGTCGGACAAGTCGGGTGTGAAATCCTCCGGCTCAACCGGAGAACTGCGCTCGAAACTGTTCGACTTGGGTACAGGAGAGGAGAGTGGAATTCCCAG0.153846
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGATGGCACAGTCAGATGTGAAATTCCTGGGCTTAACCTGGGGGCTGCATTTGATACGTGTTGTCTAGAGTGAGGAAGAGGGTCGTGGAATTCCCAG0.140351
d__BacteriaTACGGGGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGTGTAGGCGGTTTAATAAGTCAGATGTAAAAGCCCCCGGCTTAACCGGGGATTGTCATTTGAAACTGTTAGGCTTGAGTGCGAGAGAGGGTAGTGGAATTCCCAG0.137931
d__Bacteria;p__"Armatimonadetes";c__Chthonomonadetes;o__Chthonomonadales;f__Chthonomonadaceae;g__Chthonomonas/Armatimonadetes_gp3TACGGAGGGGGCGAGCGTTGTCCGAAGTTACTGGGCGTAAAGCGCGCGTAGGCGGGTTGGCAAGTCCGCTGTGAAAGCCCGGGGCTTAACCCCGGAGGGTCGGTGGATACTGCCAGTCTTGAAGGTGCCAGGGGAAGATGGAATTACCGG0.117647
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGACGCGAGTCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGCCCTGCGGGTTGTAAACCTCTTTTGCCGGGGAGTAACCGCGCCCACGCGTGGGCGTCTGAGAGTACCCGGAGAAAAAGCATCGGCTAACT0.117647
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATATGAGGATAAAGTGCGCCACTTGTGGTGCTTTGCAGGTATCATATGAATAAGGACCGGCTAATT0.117647
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTTCGGGACGTGTCCCGTTTTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.117647
d__BacteriaTGGGGAATATTGGGCAATGGGGGCAACCCTGACCCAGCAACGCCGCGTGAGGGAAGAAGGCTTTCGGGTTGTAAACCTCTTTTACCAGGGAAGAAGAAAGTGACGGTACCTGGAGAAAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.117647

Annotations:

common ontology terms
term enrichment score
TermScore
russia0.761905
tundra0.375000
siberia0.370370
nenets autonomous okrug0.240000
brackish water0.214286
caspian sea0.214286
rangifer tarandus0.214286
reindeer0.214286
age < 3 years0.193548
permafrost0.156250
omsk0.153846
peking duck0.153846
sediment depth 12-35cm0.153846
moscow0.153846
ruminal fluid0.150000
anas platyrhynchos0.133333
depth (water) 200m0.133333
intestinal contents0.125000
novosibirsk0.120000
obesity0.092308
kazan0.083333
depth (water) 150-600m0.083333
sediment depth 0-12cm0.083333
pine forest0.083333
pinus sibirica0.083333
lichen0.083333
moss0.083333
marine sediment0.082192
subgingival plaque0.080000
ph 4.50.080000
ph 40.076923
peatland0.074074
rumen0.073171
forest ecosystem0.064516
LOWER IN russia0.062500
infant0.060000
dentition0.058824
mouth0.057143
intestine0.055556
sediment0.050847
LOWER IN woodland0.044444
LOWER IN yamalo-nenets autonomous okrug0.044444
woodland0.044444
yamalo-nenets autonomous okrug0.044444
primary progressive multiple sclerosis0.043478
LOWER IN primary progressive multiple sclerosis0.043478
sediment depth 24-35cm0.043478
LOWER IN sediment depth 12-24cm0.043478
sediment depth 12-24cm0.043478
LOWER IN sediment depth 24-35cm0.043478
mature soil0.043478
LOWER IN sand0.043478
sand0.043478
LOWER IN mature soil0.043478
site 20.043478
LOWER IN site 10.043478
bifidobacterium longum probiotic0.043478
LOWER IN nenets autonomous okrug0.043478
probiotic0.042553
LOWER IN estonia0.042553
estonia0.042553
farm0.042553
LOWER IN probiotics0.041667
probiotics0.041667
periodontitis0.041667
LOWER IN periodontitis0.041667
LOWER IN finland0.039216
finland0.039216
soil0.036772
homo sapiens0.035388
LOWER IN control0.034934
winter0.032787
LOWER IN winter0.032787
adult0.031972
LOWER IN summer0.029851
summer0.029851
saliva0.029412
control0.026201
feces0.018510
Fraction of dbbact annotations with this term covered by the query
TermScore
nenets autonomous okrug1.000000
siberia1.000000
LOWER IN woodland1.000000
LOWER IN yamalo-nenets autonomous okrug1.000000
woodland1.000000
yamalo-nenets autonomous okrug1.000000
russia0.800000
tundra0.750000
kazan0.500000
primary progressive multiple sclerosis0.500000
LOWER IN primary progressive multiple sclerosis0.500000
omsk0.500000
peking duck0.500000
brackish water0.500000
caspian sea0.500000
depth (water) 150-600m0.500000
sediment depth 0-12cm0.500000
sediment depth 12-35cm0.500000
sediment depth 24-35cm0.500000
LOWER IN sediment depth 12-24cm0.500000
sediment depth 12-24cm0.500000
LOWER IN sediment depth 24-35cm0.500000
mature soil0.500000
LOWER IN sand0.500000
moscow0.500000
sand0.500000
LOWER IN mature soil0.500000
site 20.500000
LOWER IN site 10.500000
novosibirsk0.500000
bifidobacterium longum probiotic0.500000
pine forest0.500000
pinus sibirica0.500000
lichen0.500000
moss0.500000
rangifer tarandus0.500000
reindeer0.500000
LOWER IN nenets autonomous okrug0.500000
probiotic0.333333
ph 4.50.333333
age < 3 years0.333333
LOWER IN estonia0.333333
estonia0.333333
anas platyrhynchos0.250000
LOWER IN probiotics0.250000
probiotics0.250000
depth (water) 200m0.250000
permafrost0.250000
periodontitis0.250000
LOWER IN periodontitis0.250000
ph 40.250000
intestinal contents0.200000
peatland0.200000
ruminal fluid0.166667
obesity0.142857
LOWER IN finland0.142857
finland0.142857
forest ecosystem0.111111
LOWER IN russia0.100000
subgingival plaque0.071429
marine sediment0.058824
winter0.058824
LOWER IN winter0.058824
rumen0.050000
dentition0.043478
LOWER IN summer0.043478
summer0.043478
mouth0.041667
intestine0.040000
infant0.038462
sediment0.031250
farm0.027778
saliva0.021739
LOWER IN control0.021622
soil0.020202
homo sapiens0.018450
adult0.017341
control0.016216
feces0.009554
Fraction of annotations for the query sequences containing the term
TermScore
russia0.727273
homo sapiens0.431818
feces0.295455
tundra0.250000
siberia0.227273
adult0.204545
soil0.204545
sediment0.136364
brackish water0.136364
marine sediment0.136364
caspian sea0.136364
nenets autonomous okrug0.136364
rumen0.136364
ruminal fluid0.136364
rangifer tarandus0.136364
reindeer0.136364
infant0.136364
age < 3 years0.136364
permafrost0.113636
LOWER IN control0.090909
farm0.090909
intestine0.090909
anas platyrhynchos0.090909
intestinal contents0.090909
omsk0.090909
peking duck0.090909
depth (water) 200m0.090909
sediment depth 12-35cm0.090909
dentition0.090909
moscow0.090909
subgingival plaque0.090909
mouth0.090909
control0.068182
obesity0.068182
novosibirsk0.068182
saliva0.045455
kazan0.045455
depth (water) 150-600m0.045455
sediment depth 0-12cm0.045455
pine forest0.045455
ph 40.045455
forest ecosystem0.045455
pinus sibirica0.045455
peatland0.045455
ph 4.50.045455
lichen0.045455
moss0.045455
LOWER IN russia0.045455
primary progressive multiple sclerosis0.022727
LOWER IN primary progressive multiple sclerosis0.022727
LOWER IN probiotics0.022727
probiotics0.022727
sediment depth 24-35cm0.022727
LOWER IN sediment depth 12-24cm0.022727
sediment depth 12-24cm0.022727
LOWER IN sediment depth 24-35cm0.022727
mature soil0.022727
LOWER IN sand0.022727
periodontitis0.022727
LOWER IN periodontitis0.022727
sand0.022727
LOWER IN mature soil0.022727
site 20.022727
LOWER IN site 10.022727
probiotic0.022727
bifidobacterium longum probiotic0.022727
LOWER IN woodland0.022727
LOWER IN yamalo-nenets autonomous okrug0.022727
woodland0.022727
yamalo-nenets autonomous okrug0.022727
LOWER IN nenets autonomous okrug0.022727
winter0.022727
LOWER IN summer0.022727
summer0.022727
LOWER IN winter0.022727
LOWER IN finland0.022727
finland0.022727
LOWER IN estonia0.022727
estonia0.022727
Exp. ID User ID Description Date Region Flag Sequences
680amnon high in probiotic bifidobacterium longum probiotic compared to control in feces homo sapiens obesity adult russia novosibirsk 2028-03-04v3No1 / 1
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
104amnon high in control compared to periodontitis in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v4No1 / 3
141amnondominant sediment, brackish water, marine sediment, caspian sea, depth (water) 150-600m, sediment depth 0-12cm2017-04-18v4No1 / 5
104amnon high in periodontitis compared to control in homo sapiens dentition russia moscow subgingival plaque mouth 2017-04-05v4No1 / 5
426amnondominant tundra, permafrost, soil, russia, nenets autonomous okrug2018-12-08v4No1 / 8
889amnondominant rumen, russia, siberia, ruminal fluid, rangifer tarandus, reindeer2022-04-01v3No1 / 8
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 11
141amnondominant sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v4No1 / 11
790amnondominant farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 14
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v3No1 / 17
147amnondominant peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
147amnondominant tundra, soil, siberia, pine forest, ph 4, forest ecosystem, pinus sibirica2017-04-20v4No1 / 20
712amnondominant homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 23
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in farm intestine anas platyrhynchos russia intestinal contents omsk peking duck )2021-06-07v3No1 / 25
104amnondominant homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 27
241amnoncommon in babies age < 3 years in russia (common feces, homo sapiens, infant, russia, age < 3 years)2017-11-13v4No1 / 44
141amnonpositively correlated with sample depth ( high in sediment depth 24-35cm compared to sediment depth 12-24cm in sediment brackish water marine sediment caspian sea depth (water) 200m sediment depth 12-35cm )2017-04-18v4No1 / 56
790amnoncommon farm, intestine, anas platyrhynchos, russia, intestinal contents, omsk, peking duck2021-06-07v3No1 / 61
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
426amnoncommon tundra, permafrost, soil, russia, nenets autonomous okrug2018-12-08v4No1 / 81
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
426amnon high in sand compared to mature soil in tundra permafrost soil russia nenets autonomous okrug 2018-12-08v4No1 / 125
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 146
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 148
889amnon high in woodland yamalo-nenets autonomous okrug compared to nenets autonomous okrug in tundra rumen russia siberia ruminal fluid rangifer tarandus reindeer 2022-04-01v3No1 / 151
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 169
141amnonnegatively correlated with sample depth ( high in sediment depth 12-24cm compared to sediment depth 24-35cm in sediment brackish water marine sediment caspian sea depth (water) 200m sediment depth 12-35cm )2017-04-18v4No1 / 187
889amnon high in winter compared to summer in tundra rumen russia siberia ruminal fluid rangifer tarandus reindeer 2022-04-01v3No1 / 205
104amnoncommon homo sapiens, dentition, russia, moscow, subgingival plaque, mouth2017-04-05v4No1 / 227
426amnon high in site 2 compared to site 1 in tundra permafrost soil russia nenets autonomous okrug 2018-12-08v4No1 / 228
889amnon high in nenets autonomous okrug compared to woodland yamalo-nenets autonomous okrug in tundra rumen russia siberia ruminal fluid rangifer tarandus reindeer 2022-04-01v3No1 / 247
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
426amnon high in mature soil compared to sand in tundra permafrost soil russia nenets autonomous okrug 2018-12-08v4No1 / 377
147amnoncommon peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 396
147amnoncommon tundra, soil, siberia, pine forest, ph 4, forest ecosystem, pinus sibirica2017-04-20v4No1 / 416
889amnoncommon rumen, russia, siberia, ruminal fluid, rangifer tarandus, reindeer2022-04-01v3No1 / 469
889amnon high in summer compared to winter in tundra rumen russia siberia ruminal fluid rangifer tarandus reindeer 2022-04-01v3No1 / 647
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 150-600m, sediment depth 0-12cm2017-04-18v4No1 / 1549
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v4No1 / 1659

Problems / suggestions? Please email info AT dbbact DOT org