Summary for ontology term: saliva

Number of annotations with term: 269

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.044534
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.032389
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAAACTTCCGGCTCAACCGGGGGCTTGCGGTGGGTACGGGCCGGCTAGAGTGCGGTAGGGGTAACTGGAACTCCTGG0.032389
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.032389
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.032389
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.028340
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGAAATGCAAGTTAGTTGTGAAATACCTCGGCTTAACTGAGGAACTGCAACTAAAACTATATTTCTTGAGTATCGGAGGGGTTTGTGGAATTCCTAG0.028340
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae"TACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGATATACAAGTCAGGGGTGAAAACTTAGGGCTCAACTCAAAGCTTGCCTTTGAAACTGTATATCTAGAGTGCTGGAGAGGTGGACGGAACTACACG0.028340
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGTTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.028340
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.028340

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.291667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Cardiobacteriales;f__Cardiobacteriaceae;g__CardiobacteriumTACGGAGGGTGCGAGCGTTATTCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGCCCAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGGCGACTAGAGTATGAAAGAGGAAAGCGGAATTTCCAG0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTAGCTAGAGTATGTCAGAGGGGGGTAGAATTCCACG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.208333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGAGATTAAGTGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCATACTGGTTTCCTTGAGTACGCACAACGTTGGCGGAATTCGTCG0.377358
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.369565
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.362720
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGCGGTGAAATCTAGGAGCTTAACTCCTAAATTGCCATTGATACTGGCGGGCTTGAGTGTAGATGAGGTAGGCGGAATGCGTGG0.339332
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGACGGTGGCTCAACCATCGTTAGCCATTGAAACTGGTAGTCTTGAGTGCAGACAGGGATGCTGGAACTCGTGGT0.323232
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.320442
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.309565
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACCCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.305949
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCAGGGAAGAAGAGAGATTGACGGTACCTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.302083
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTTGTTCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.297872

Annotations:

common ontology terms
term enrichment score
TermScore
saliva0.972222
homo sapiens0.259470
child0.233647
adult0.227621
infant0.160808
oral cavity0.154286
LOWER IN saliva0.143133
sweden0.127505
municipality of umea0.123779
mouth0.111448
united states of america0.109542
oral wash0.095400
4-year-old human stage0.092199
canada0.089109
state of victoria0.086154
no dental caries0.085409
2-year-old human stage0.075601
LOWER IN dentition0.073181
dentition0.067170
age 5-10 years0.063717
human adult stage0.063158
istanbul0.062718
age 13-15 years0.062718
turkey0.060811
14-year-old human stage0.060811
13-year-old human stage0.059016
felis catus0.058158
china0.057414
control0.056808
sichuan province0.054115
equus caballus0.052770
horse0.052770
state of new york0.052689
female0.051392
18-month-old human stage0.050725
LOWER IN control0.050391
venezuela0.050089
amerindian0.050089
supragingival plaque0.050000
LOWER IN supragingival plaque0.050000
hunter gatherer0.048866
canis lupus familiaris0.048309
amsterdam0.046053
australia0.043277
age 7-14 years0.042705
age 4 years0.042705
late adult stage0.042705
shanghai proper0.041812
10-15-years-old human0.041812
beagle dog0.041812
hong kong0.041812
kingdom of spain0.041754
3-month-old human stage0.041379
12-month-old human stage0.041379
bolivia0.040956
state of texas0.040956
city0.040462
state of illinois0.037855
1-year-old human stage0.037152
LOWER IN child0.036641
LOWER IN 4-year-old human stage0.036496
supragingival dental plaque0.036101
LOWER IN supragingival dental plaque0.036101
barn0.035842
italy0.035821
6-month-old human stage0.035524
2-month-old human stage0.035211
hay0.035211
atlanta0.035211
female organism0.033994
adult organism0.033994
LOWER IN infant0.033445
cat0.032895
germany0.032877
japan0.032345
human early adulthood stage0.032345
LOWER IN mouth0.032189
farm0.031299
3-year-old human stage0.028881
macaca fascicularis0.028881
cynomolgus macaque0.028881
city of dresden0.028881
jinan city prefecture0.028881
LOWER IN oral wash0.028743
LOWER IN 2-year-old human stage0.028605
toronto0.028470
shanghai district0.028470
LOWER IN 3-month-old human stage0.028269
dog0.028235
type 2 diabetes mellitus0.028070
state of california0.027842
pair of nares0.027810
third decade human stage0.027682
1-month-old human stage0.027304
commonwealth of pennsylvania0.025890
captive0.022663
2-days-old human0.021818
5-year-old human stage0.021818
non-pregnant0.021818
cheek pouch0.021818
Fraction of dbbact annotations with this term covered by the query
TermScore
saliva1.042553
18-month-old human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
10-month-old human stage1.000000
11-month-old human stage1.000000
13-month-old human stage1.000000
14-month-old human stage1.000000
7-month-old human stage1.000000
8-month-old human stage1.000000
9-month-old human stage1.000000
19-month-old human stage1.000000
20-month-old human stage1.000000
21-month-old human stage1.000000
no dental caries1.000000
age 5-10 years0.666667
dental caries0.666667
LOWER IN dental caries0.666667
venezuela0.666667
amerindian0.666667
supragingival plaque0.636364
LOWER IN supragingival plaque0.636364
supragingival dental plaque0.625000
LOWER IN supragingival dental plaque0.625000
oral wash0.571429
municipality of umea0.500000
2-days-old human0.500000
5-year-old human stage0.500000
3-year-old human stage0.500000
LOWER IN 2-days-old human0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
2-year-old human stage0.500000
age 21-28 years0.500000
age 7-14 years0.500000
autism0.500000
LOWER IN autism0.500000
non-pregnant0.500000
LOWER IN non-pregnant0.500000
cornell university0.500000
LOWER IN bronchial brush0.500000
bronchial brush0.500000
induced sputum0.500000
LOWER IN induced sputum0.500000
atherosclerosis0.500000
cheek pouch0.500000
macaca fascicularis0.500000
cynomolgus macaque0.500000
LOWER IN cheek pouch0.500000
city of dresden0.500000
istanbul0.500000
kazan0.500000
age 4 years0.500000
LOWER IN braces0.500000
LOWER IN teeth braces0.500000
age 13-15 years0.500000
braces0.500000
teeth braces0.500000
diet without sweets0.500000
LOWER IN diet containing sweets0.500000
diet containing sweets0.500000
LOWER IN diet without sweets0.500000
LOWER IN age 13-15 years0.500000
LOWER IN barn0.500000
barn0.500000
LOWER IN asthma0.500000
asthma0.500000
stimulated saliva0.500000
LOWER IN cheek0.500000
cheek0.500000
endurance athlete0.500000
late adult stage0.500000
jinan city prefecture0.500000
LOWER IN oral wash0.428571
6-month-old human stage0.400000
hunter gatherer0.400000
LOWER IN 2-year-old human stage0.375000
LOWER IN saliva0.361702
dentition0.347826
LOWER IN dentition0.347826
toronto0.333333
slovak republic0.333333
shanghai proper0.333333
autistic disorder0.333333
LOWER IN autistic disorder0.333333
LOWER IN third trimester0.333333
third trimester0.333333
2-month-old human stage0.333333
LOWER IN bronchus0.333333
bronchus0.333333
oral cavity0.333333
LOWER IN subgingival dental plaque0.333333
subgingival dental plaque0.333333
turkey0.333333
10-15-years-old human0.333333
LOWER IN 10-15-years-old human0.333333
LOWER IN age 5-10 years0.333333
beagle dog0.333333
cameroon0.333333
Fraction of annotations for the query sequences containing the term
TermScore
saliva0.910781
homo sapiens0.877323
adult0.386617
united states of america0.330855
child0.271375
sweden0.130112
infant0.122677
china0.118959
oral cavity0.100372
LOWER IN saliva0.089219
mouth0.085502
municipality of umea0.070632
canada0.066914
control0.055762
australia0.052045
state of victoria0.052045
oral wash0.052045
4-year-old human stage0.048327
LOWER IN control0.044610
human adult stage0.044610
female0.044610
no dental caries0.044610
LOWER IN dentition0.040892
2-year-old human stage0.040892
dentition0.037175
canis lupus familiaris0.037175
research facility0.037175
kingdom of spain0.037175
farm0.037175
equus caballus0.037175
horse0.037175
felis catus0.033457
age 5-10 years0.033457
turkey0.033457
istanbul0.033457
age 13-15 years0.033457
13-year-old human stage0.033457
14-year-old human stage0.033457
sichuan province0.029740
state of new york0.029740
18-month-old human stage0.026022
supragingival plaque0.026022
LOWER IN supragingival plaque0.026022
amsterdam0.026022
venezuela0.026022
amerindian0.026022
hunter gatherer0.026022
city0.026022
3-month-old human stage0.022305
LOWER IN child0.022305
1-year-old human stage0.022305
bolivia0.022305
state of texas0.022305
shanghai proper0.022305
age 7-14 years0.022305
italy0.022305
japan0.022305
human early adulthood stage0.022305
12-month-old human stage0.022305
germany0.022305
10-15-years-old human0.022305
state of illinois0.022305
beagle dog0.022305
dog0.022305
female organism0.022305
adult organism0.022305
age 4 years0.022305
state of california0.022305
late adult stage0.022305
hong kong0.022305
LOWER IN infant0.018587
supragingival dental plaque0.018587
LOWER IN supragingival dental plaque0.018587
LOWER IN mouth0.018587
LOWER IN 4-year-old human stage0.018587
cat0.018587
2-month-old human stage0.018587
6-month-old human stage0.018587
hay0.018587
barn0.018587
atlanta0.018587
3-year-old human stage0.014870
LOWER IN 3-month-old human stage0.014870
toronto0.014870
third decade human stage0.014870
pair of nares0.014870
LOWER IN adult0.014870
LOWER IN 2-year-old human stage0.014870
1-month-old human stage0.014870
LOWER IN oral wash0.014870
commonwealth of pennsylvania0.014870
captive0.014870
macaca fascicularis0.014870
cynomolgus macaque0.014870
type 2 diabetes mellitus0.014870
city of dresden0.014870
shanghai district0.014870
jinan city prefecture0.014870
2-days-old human0.011152
5-year-old human stage0.011152
Exp. ID User ID Description Date Region Flag Sequences
158amnon high in pair of nares compared to saliva mouth in united states of america felis catus cat 2017-07-06v4No1 / 1
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 1
919amnon high in breast fed compared to formula fed in homo sapiens saliva infant australia state of victoria 1-month-old human stage 2-month-old human stage 2022-07-17v4No1 / 1
384amnon high in asthma compared to control in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 1
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
455amnonColonizes gut as well as saliva (other feces, homo sapiens, saliva)2019-11-25v4No1 / 2
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
919amnon high in formula fed compared to breast fed in homo sapiens saliva infant australia state of victoria 1-month-old human stage 2-month-old human stage 2022-07-17v4No1 / 3
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 5
919amnon high in 12-month-old human stage compared to 2-year-old human stage in homo sapiens saliva infant australia state of victoria 2022-07-17v4No1 / 5
598amnon high in male compared to female in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
598amnon high in female compared to male in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 5
919amnondominant homo sapiens, saliva, infant, australia, state of victoria, 1-month-old human stage, 2-month-old human stage2022-07-17v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 6
384amnon high in control compared to asthma in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 6
892amnon high in 4-year-old human stage compared to 2-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 7
679amnondominant homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 7
919amnon high in 2-month-old human stage compared to 12-month-old human stage in homo sapiens saliva infant australia state of victoria 2022-07-17v4No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
806amnon high in oral cavity oral wash compared to saliva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 7
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 8
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 1-month-old human stage, 2-month-old human stage2022-07-17v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 10
919amnondominant homo sapiens, saliva, infant, australia, state of victoria2022-07-17v4No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to braces teeth braces in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 11
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
918amnon high in non-pregnant compared to pregnancy third trimester in homo sapiens female saliva adult japan human early adulthood stage 2022-07-15v3No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 13
546amnondominant homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 14
919amnondominant homo sapiens, saliva, infant, australia, state of victoria, 10-month-old human stage, 11-month-old human stage, 12-month-old human stage, 13-month-old human stage, 14-month-old human stage2022-07-17v4No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
919amnondominant homo sapiens, saliva, infant, australia, state of victoria, 2-year-old human stage, 18-month-old human stage, 19-month-old human stage, 20-month-old human stage, 21-month-old human stage2022-07-17v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
384amnondominant farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 15
846amnondominant homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
892amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
922amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in infant obsolete_juvenile stage compared to adult in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
892amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 17
32amnondominant homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
922amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to infant obsolete_juvenile stage in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 17
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 17
852amnondominant homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
26amnondominant united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 18
892amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 18
892amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
922amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v4No1 / 18
922amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v4No1 / 18
817amnondominant united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
384amnondominant farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 18
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
704amnondominant homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
26amnondominant united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 20
158amnondominant united states of america, saliva, felis catus, cat, mouth2017-07-06v4No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
704amnon high in periodontitis compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
918amnon high in pregnancy third trimester compared to non-pregnant in homo sapiens female saliva adult japan human early adulthood stage 2022-07-15v3No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
918amnondominant homo sapiens, female, pregnancy, saliva, adult, japan, third trimester, human early adulthood stage2022-07-15v3No1 / 22
918amnondominant homo sapiens, female, saliva, adult, japan, non-pregnant, human early adulthood stage2022-07-15v3No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 22
704amnondominant homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 23
712amnondominant homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
354amnon high in sputum induced sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in homo sapiens saliva child turkey istanbul )2028-04-02v3No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens saliva )2018-09-06v4No1 / 24
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
826amnondominant united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 26
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in homo sapiens saliva child turkey istanbul )2028-04-02v3No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 28
817amnon high in lung bronchoalveolar lavage compared to saliva oral cavity oral wash cheek pouch in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
704amnon high in control compared to dental caries in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 29
246amnon high in body mass index high bmi obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
774amnon high in tonsillitis compared to control in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 30
652amnon high in control compared to rheumatoid arthritis in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 31
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
892amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 33
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 33
922amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v4No1 / 33
919amnoncommon 6-month-old human stage, 7-month-old human stage, 8-month-old human stage, 9-month-old human stage, homo sapiens, saliva, infant, australia, state of victoria2022-07-17v4No1 / 34
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
892amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 40
679amnon high in tonsil palatine tonsil compared to saliva in homo sapiens fasting child south korea age 5-10 years 2028-03-02v3No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
555amnon high in control compared to autistic disorder autism in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 43
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
32amnoncommon homo sapiens, saliva, infant, bolivia2016-12-05v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
640amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 47
546amnoncommon homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 48
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 50
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in child age 13-15 years 13-year-old human stage 14-year-old human stage compared to adult in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 52
892amnon high in supragingival plaque dental plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 53
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 55
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 55
922amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v4No1 / 56
817amnon high in saliva oral cavity oral wash cheek pouch compared to lung bronchoalveolar lavage in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 56
775amnon high in lichen planus compared to control in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
892amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
922amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage no dental caries 2022-07-25v4No1 / 58
892amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 59
922amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v4No1 / 59
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 10-month-old human stage, 11-month-old human stage, 12-month-old human stage, 13-month-old human stage, 14-month-old human stage2022-07-17v4No1 / 62
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 63
919amnoncommon homo sapiens, saliva, infant, australia, state of victoria, 2-year-old human stage, 18-month-old human stage, 19-month-old human stage, 20-month-old human stage, 21-month-old human stage2022-07-17v4No1 / 65
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
852amnoncommon homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 66
846amnoncommon homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 69
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 79
777amnon high in 3-year-old human stage compared to 5-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
892amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 87
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
919amnon high in 2-year-old human stage compared to 12-month-old human stage in homo sapiens saliva infant australia state of victoria 2022-07-17v4No1 / 87
922amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v4No1 / 88
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
918amnoncommon homo sapiens, female, saliva, adult, japan, non-pregnant, human early adulthood stage2022-07-15v3No1 / 93
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 95
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
922amnon high in child 4-year-old human stage compared to adult human adult stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 97
26amnoncommon united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 99
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
922amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage no dental caries 2022-07-25v4No1 / 102
704amnon high in dental caries compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 102
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 102
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
918amnoncommon homo sapiens, female, pregnancy, saliva, adult, japan, third trimester, human early adulthood stage2022-07-15v3No1 / 104
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 105
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
892amnon high in saliva compared to supragingival plaque dental plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 124
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
26amnon high in saliva mouth compared to mucus pair of nares in united states of america felis catus 2016-12-05v4No1 / 138
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 150
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 157
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
26amnoncommon united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 163
919amnon high in 12-month-old human stage compared to 2-month-old human stage in homo sapiens saliva infant australia state of victoria 2022-07-17v4No1 / 164
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
555amnon high in dentition supragingival plaque compared to saliva in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 184
26amnon high in saliva mouth compared to mucus pair of nares in united states of america canis lupus familiaris 2016-12-05v4No1 / 187
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
158amnoncommon united states of america, saliva, felis catus, cat, mouth2017-07-06v4No1 / 189
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 200
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 211
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 216
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
826amnoncommon united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 233
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
596amnon high in age 1-7 years 2-5 year-old child stage compared to under-1-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
922amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 291
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
158amnonlower in skin sites compared to mouth in cats ( high in saliva mouth compared to skin in united states of america felis catus cat )2017-07-06v4No1 / 346
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791

Problems / suggestions? Please email info AT dbbact DOT org