Summary for ontology term: sea water

Number of annotations with term: 220

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.057692
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.057692
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTATTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGATTCACTAGAGTACGATAGAGGGAGGTAGAATTCACAG0.057692
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.052885
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGTTAGTAGAATTTCCAG0.052885
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.052885
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGCTCGTAGGTGGTTAAAAAAGTTGATGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCATCAAAACTTTTTAGCTAGAGTGTGATAGAGGTAAGTGGAATTTCTAG0.052885
d__BacteriaTACGAAGGGGGCGAGCGTTATTCGGAATTATTGGGCGTAAAGGGCTCGCAGGCTGCTTGAACAGTTAGACGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTTAATACTAGCAAGCTAGAGAAATAGAGAGGAAAGTGGAACTCCCAG0.052885
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales"TACGGAGGGTGCAAGCGTTATCCGGATTTATTAGGTTTAAAGGGTCCGCAGGCGGAATATTAAGTCAGTGGTGAAAGCCTACAGCTCAACTGTAGAACTGCCATTGAAACTGTTATTCTTGAGTATGGATGAAGTGGGCGGAATATGTCA0.048077
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCAAGCGTTATCCGGATTCATTGGGTTTAAAGGGTCCGTAGGCGGGTCTTTAAGTCAGTGGTGAAAGCCGACAGCTCAACTGTCGAACTGCCATTGATACTGGAGACCTTGAGTACAAATGAAGTAGGCGGAATGAGTCA0.048077

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.428571
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTGATCAGTTGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTCAATACTGTCAGTCTTGAGTCCGAGAGAGGTGAGTGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.357143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTCAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.357143
d__BacteriaAACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGCTTAGTAGGTTGGACGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACCGCTAGGCTCGAGGGCGGAAGAGGGGAGTGGAATTCCCGG0.357143
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAATAAGTCAACTGTTAAATCTTGAGGCTCAACCTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAG0.357143
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCAAACGTTGCTCGGATTTACTGGGCGTAAAGCGCGTGTAGGCGGACTCGCAAGTCGGTTGTGAAATCCCTGGGCTCAACCTAGGAACTGCATCCGAAACTGCTTGTCTTGAGTAATGGAGAGGGTGGCGGAATTCCCGG0.357143
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCGAACGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGATAAGTGGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCCAAACTGTCAGGCTAGAGTATGGTAGAGGGAGGTAGAATTTCCTG0.357143
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp17;g__Gp17GACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGCAGGCGGTTCGTCAAGTCCCGTGTGAAATCCCCCGGCTCAACTGGGGAACTGCGCGGGAAACTAGCGGGCTTGAGTTCGGGAGAGGAAAGCGGAATTCCGGG0.357143
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__Planctomycetaceae;g__RhodopirellulaGACGAACCGTCCAAACGTTATTCGGTATCACTGGGCTTAAAGCGTGCGTAGGCGGCTTGGTAGGTGAGATGTGAAAGCCCACGGCTCAACCGTGGAATTGCGTTTCAAACCCCCAAGCTCGAGGAAGATAGGGGTGATGGGAACTTATGG0.357143

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.515942
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.503401
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATTAATAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAAAACTGTTAGTCTTGAGATCGAGAGAGGTGAGTGGAATTCCAAG0.490323
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGCTCGTAGGTGGTTAAAAAAGTTGATGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCATCAAAACTTTTTAGCTAGAGTGTGATAGAGGTAAGTGGAATTTCTAG0.482759
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.481375
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.478873
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTATTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGATTCACTAGAGTACGATAGAGGGAGGTAGAATTCACAG0.466216
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTAAGTGGAATTCCGAG0.462025
d__BacteriaTACATAGGGGTCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCAACAAGTCGGTCGTAAAAGTTTAGGGCTCAACCCTAAAATGTCGATCGATACTGTTGTGACTAGGATACGGTAGAGGTGAATGGAATTCCGA0.457912
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__TenacibaculumTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTTAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTTATACGGAAGTAGATAGAATAAGTAG0.432787

Annotations:

common ontology terms
term enrichment score
TermScore
sea water1.004501
surface water0.465696
pacific ocean0.452736
water0.389785
state of california0.267964
monterey bay0.213740
saline water0.192308
ocean0.190045
atlantic ocean0.186720
okinawa islands0.112903
near shore0.106870
LOWER IN sea water0.103550
japan0.102564
english channel coastal waters of france0.098361
coast0.093750
filtered 0.2um0.092105
beach0.090909
aquarium0.089552
mediterranean sea0.083333
biofilm0.082192
united states of america0.077717
summer0.071429
marine sediment0.069700
philippine sea0.067797
normal weather0.067797
depth (water) 0-20cm0.064516
french republic0.061856
depth (water) 20-100cm0.061538
bermuda0.059829
autumn0.058824
newport river estuary0.053097
town of beaufort0.053097
depth (water) 300m0.052402
depth (water) 5m0.052174
hydrothermal vent0.051724
greece0.051724
marine hydrothermal vent0.051724
volcanic rock0.051724
volcanic crater0.051724
trichodesmium0.051724
depth (water) 20m0.051724
depth (water) 150m0.051724
saanich inlet0.051724
depth (water) 4m0.051724
water inlet0.051724
coastal water0.051724
guinea0.051724
depth (water) 3m0.051724
hokkaido0.050420
san diego0.049180
fish farm0.048000
canada0.047059
LOWER IN water0.044269
depth (water) 100m0.043956
state of florida0.043796
commonwealth of massachusetts0.043796
depth (water) 200m0.043478
shenzhen city prefecture0.043478
size < 1um0.043478
size 1-80um0.043478
depth (water) 25cm0.043478
depth (water) 5-50m0.042553
litopenaeus vannamei0.041667
pacific white shrimp0.041667
particle bound0.041667
LOWER IN summer0.040000
free floating0.040000
depth (water) 0cm0.035088
south florida0.035088
nan'ao island0.035088
chitin beads0.035088
biofilm material0.035088
metal0.035088
hawaii0.034783
state of connecticut0.034483
LOWER IN surface water0.034483
portuguese republic0.034483
city0.034091
estuary0.033898
new york city0.032258
winter0.031008
state of new york0.029412
australia0.029197
LOWER IN saline water0.028986
deep bay0.026906
mirs bay0.026906
LOWER IN depth (water) 0cm0.026786
active vent0.026549
inactive vent0.026549
depth (water) 150-500m0.026549
depth (water) 75m0.026549
tropical storm0.026549
storm0.026549
typhoon0.026549
china0.026201
south china sea0.026201
indian ocean0.025862
late time points0.025862
LOWER IN early time points0.025862
LOWER IN late time points0.025862
Fraction of dbbact annotations with this term covered by the query
TermScore
surface water1.166667
sea water1.083333
deep bay1.000000
mirs bay1.000000
LOWER IN deep bay1.000000
LOWER IN mirs bay1.000000
sugar kelp1.000000
saccharina latissima1.000000
LOWER IN saccharina latissima1.000000
LOWER IN sugar kelp1.000000
newport river estuary1.000000
town of beaufort1.000000
coast0.750000
LOWER IN depth (water) 0cm0.750000
monterey bay0.666667
depth (water) 100m0.666667
depth (water) 300m0.666667
LOWER IN depth (water) 300m0.666667
depth (water) 5m0.600000
hydrothermal vent0.500000
greece0.500000
mediterranean sea0.500000
marine hydrothermal vent0.500000
volcanic rock0.500000
volcanic crater0.500000
active vent0.500000
inactive vent0.500000
LOWER IN active vent0.500000
LOWER IN inactive vent0.500000
haliotis sorenseni0.500000
white abalone0.500000
bermuda0.500000
porites astreoides0.500000
LOWER IN porites astreoides0.500000
beginning0.500000
LOWER IN beginning0.500000
coral sea0.500000
great barrier reef0.500000
trichodesmium0.500000
pacific ocean0.500000
south pacific ocean0.500000
sargasso sea0.500000
depth (water) 150-500m0.500000
depth (water) 2000-4000m0.500000
deth 5-100m0.500000
depth (water) 30m0.500000
depth (water) 500m0.500000
bodega bay0.500000
depth (water) 200m0.500000
depth (water) 80m0.500000
depth (water) 20m0.500000
depth (water) 60m0.500000
depth (water) 75m0.500000
depth (water) 150m0.500000
LOWER IN depth (water) 150m0.500000
LOWER IN depth (water) 75m0.500000
pearl harbor0.500000
depth (water) 0cm0.500000
south florida0.500000
gulf of naples0.500000
LOWER IN shark0.500000
shark0.500000
shenzhen city prefecture0.500000
starfish0.500000
patiria pectinifera0.500000
LOWER IN starfish0.500000
LOWER IN patiria pectinifera0.500000
asterias amurensis0.500000
LOWER IN asterias amurensis0.500000
saanich inlet0.500000
depth (water) 4m0.500000
shore0.500000
philippine sea0.500000
sea urchin0.500000
artificial seawater0.500000
LOWER IN cold water inlet0.500000
hot water inlet0.500000
water inlet0.500000
english channel coastal waters of france0.500000
LOWER IN hot water inlet0.500000
cold water inlet0.500000
LOWER IN water inlet0.500000
LOWER IN saline water biofilm0.500000
saline water biofilm0.500000
nan'ao island0.500000
eunicella labiata0.500000
gorgonian coral0.500000
LOWER IN eunicella labiata0.500000
LOWER IN gorgonian coral0.500000
size < 1um0.500000
LOWER IN size 1-80um0.500000
size 1-80um0.500000
LOWER IN size &lt; 1um0.500000
okinawa islands0.500000
LOWER IN tropical storm0.500000
normal weather0.500000
LOWER IN normal weather0.500000
tropical storm0.500000
LOWER IN storm0.500000
LOWER IN typhoon0.500000
Fraction of annotations for the query sequences containing the term
TermScore
sea water0.936364
water0.481818
pacific ocean0.413636
surface water0.290909
state of california0.277273
united states of america0.240909
saline water0.227273
atlantic ocean0.131818
ocean0.127273
monterey bay0.127273
japan0.090909
china0.068182
LOWER IN sea water0.063636
okinawa islands0.063636
filtered 0.2um0.063636
near shore0.063636
english channel coastal waters of france0.054545
french republic0.054545
coast0.050000
aquarium0.050000
summer0.050000
biofilm0.050000
beach0.050000
mediterranean sea0.045455
marine sediment0.040909
depth (water) 20-100cm0.036364
depth (water) 0-20cm0.036364
canada0.036364
philippine sea0.036364
autumn0.036364
normal weather0.036364
bermuda0.031818
LOWER IN water0.031818
hydrothermal vent0.027273
greece0.027273
marine hydrothermal vent0.027273
volcanic rock0.027273
volcanic crater0.027273
research facility0.027273
trichodesmium0.027273
depth (water) 5m0.027273
depth (water) 20m0.027273
depth (water) 300m0.027273
depth (water) 150m0.027273
newport river estuary0.027273
town of beaufort0.027273
state of florida0.027273
city0.027273
hokkaido0.027273
saanich inlet0.027273
depth (water) 4m0.027273
water inlet0.027273
fish farm0.027273
north america0.027273
coastal water0.027273
commonwealth of massachusetts0.027273
san diego0.027273
guinea0.027273
depth (water) 3m0.027273
LOWER IN summer0.022727
depth (water) 100m0.022727
depth (water) 200m0.022727
depth (water) 5-50m0.022727
litopenaeus vannamei0.022727
pacific white shrimp0.022727
shenzhen city prefecture0.022727
digestive system0.022727
free floating0.022727
size < 1um0.022727
particle bound0.022727
size 1-80um0.022727
depth (water) 25cm0.022727
LOWER IN control0.018182
australia0.018182
winter0.018182
state of connecticut0.018182
LOWER IN surface water0.018182
estuary0.018182
state of new york0.018182
new york city0.018182
hawaii0.018182
depth (water) 0cm0.018182
south florida0.018182
LOWER IN saline water0.018182
nan'ao island0.018182
portuguese republic0.018182
chitin beads0.018182
biofilm material0.018182
metal0.018182
deep bay0.013636
active vent0.013636
inactive vent0.013636
mirs bay0.013636
depth (water) 150-500m0.013636
LOWER IN biofilm0.013636
LOWER IN depth (water) 0cm0.013636
depth (water) 75m0.013636
sediment0.013636
LOWER IN marine sediment0.013636
LOWER IN sediment0.013636
Exp. ID User ID Description Date Region Flag Sequences
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system sea water china )2017-03-06v4No1 / 1
9amnonmuch higher when coral is present ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 2
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 2
483amnondominant hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 4
550amnon high in starfish wild coelomic fluid asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v4No1 / 5
136amnondominant sea water, trichodesmium, ocean, pacific ocean, north pacific ocean2017-04-17v4No1 / 7
136amnondominant sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 8
235amnoncommon in ocean water above eelgrass from various northern hemisphere sites (common water, sea water)2017-11-07v4No1 / 8
807amnondominant tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 8
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 9
642amnoncommon saline water, surface water, water, sea water, san diego, pacific ocean2020-08-28v4No1 / 10
136amnondominant sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 11
970amnondominant sea water, atlantic ocean, united states of america, town of beaufort, newport river estuary, surface water, depth (water) 0-20cm, winter2022-12-23v3No1 / 11
496amnondominant water, canada, saanich inlet, pacific ocean, depth (water) 200m, sea water2019-03-03v4No1 / 11
355amnondominant canada, province of british columbia, calvert island, pacific ocean, ocean, surface water, sea water2018-08-01v4No1 / 11
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 12
951amnondominant sea water, surface water, china, coast, depth (water) 20-100cm, mirs bay2022-12-08v3No1 / 12
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 500m, sea water2019-01-16v4No1 / 12
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 80m, sea water2019-01-16v4No1 / 12
970amnondominant sea water, atlantic ocean, united states of america, town of beaufort, newport river estuary, surface water, depth (water) 0-20cm, summer2022-12-23v3No1 / 12
323amnondominant depth (water) 0cm, depth (soil) 0-20cm, water, atlantic ocean, south florida, state of florida, united states of america, surface water, sea water2018-04-24v4No1 / 12
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water, aquarium)2018-07-30v4No1 / 12
676amnondominant water inlet, english channel coastal waters of france, saline water, sea water, french republic2028-02-27v4No1 / 12
807amnondominant storm, typhoon, autumn, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 12
699amnondominant united states of america, state of north carolina, state of south carolina, florida, atlantic ocean, saline water, sea water2028-04-01v4No1 / 12
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 100m, sea water2019-01-16v4No1 / 13
461amnondominant water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 13
642amnondominant saline water, surface water, water, sea water, san diego, pacific ocean2020-08-28v4No1 / 13
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 200m, sea water2019-01-16v4No1 / 14
342amnondominant water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 14
676amnondominant aquarium, fish farm, french republic, sea water, saline water, english channel coastal waters of france2028-02-27v4No1 / 14
807amnondominant autumn, normal weather, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 14
807amnondominant normal weather, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 14
138amnonhigh freq. in ocean water depth 1000m (dominant sea water, ocean, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 15
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 60m, sea water2019-01-16v4No1 / 15
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
496amnondominant water, canada, saanich inlet, pacific ocean, depth (water) 100m, sea water2019-03-03v4No1 / 15
342amnondominant water, pacific ocean, philippine sea, depth (water) 150m, sea water2018-05-28v4No1 / 15
342amnondominant water, pacific ocean, philippine sea, depth (water) 300m, sea water2018-05-28v4No1 / 15
984amnondominant state of california, united states of america, pacific ocean, sea water, surface water, depth (water) 0-20cm2022-12-26v4No1 / 15
304amnondominant united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 15
308amnonhigh freq. in water of aquarium with red abalone (dominant red abalone, haliotis rufescens, united states of america, state of california, research facility, water, sea water, aquarium)2018-03-30v4No1 / 15
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 40m, sea water2019-01-16v4No1 / 16
317amnondominant depth (water) 150m, water, united states of america, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, sea water2018-04-15v4No1 / 16
85amnondominant litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 16
505amnondominant water, pacific ocean, state of california, surface water, particle bound, size 1-80um, sea water2019-03-14v4No1 / 16
807amnon high in normal weather compared to tropical storm in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 16
304amnondominant united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 16
138amnonhigh freq. in ocean water depth 2000-4000m (dominant sea water, ocean, pacific ocean, depth (water) 2000-4000m)2017-04-18v4No1 / 17
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 30m, sea water2019-01-16v4No1 / 17
317amnondominant water, united states of america, state of california, pacific ocean, surface water, depth (water) 5m, sea water2018-04-15v4No1 / 17
433amnondominant sea water, ocean, depth (water) 4m, south china sea, coast2018-12-19v4No1 / 17
807amnonlower during typhoon with red soil pollution compared to normal weather ( high in normal weather compared to storm typhoon in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 17
362amnondominant hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 18
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 18
887amnondominant great barrier reef, coral sea, australia, sea water, saline water2022-03-28v4No1 / 18
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 5m, sea water2019-01-16v4No1 / 18
504amnondominant nan'ao island, water, sea water, china2019-03-14v4No1 / 18
222amnondominant water, sea water, guinea, depth (water) 3m2017-10-26v4No1 / 18
138amnonhigh freq. in ocean water depth 150-500m (dominant sea water, ocean, pacific ocean, depth (water) 150-500m)2017-04-18v4No1 / 19
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 20m, sea water2019-01-16v4No1 / 19
280amnon high in eunicella labiata coral reef gorgonian coral coral compared to saline water sea water marine water body in atlantic ocean depth (water) 20m portuguese republic 2018-01-25v4No1 / 19
635amnondominant hervey bay, surface water, sea water, australia2020-08-03v1No1 / 19
951amnondominant in ocean water close to river outlet (dominant sea water, surface water, china, deep bay, coast, depth (water) 20-100cm)2022-12-08v3No1 / 20
9amnondominant bermuda, sea water2016-10-27v4No1 / 20
965amnondominant depth (water) 5-50m, atlantic ocean, united states of america, state of connecticut, sea water2022-12-21v3No1 / 20
722amnondominant estuary, united states of america, state of new york, new york city, sea water, surface water2021-01-02v4No1 / 20
550amnondominant sea water, hokkaido, city, japan2019-08-18v4No1 / 20
93amnonhigh freq. in seawater near the shore in hawaii (dominant hawaii, sea water, shore)2017-03-12v4No1 / 20
222amnonhigh freq. on inner biofilm on metal plate in ocean water (dominant biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal)2017-10-26v4No1 / 20
236amnondominant ocean, pacific ocean, state of california, bodega bay, water, sea water2017-11-07v4No1 / 21
473amnondominant water, saline water, pacific ocean, state of california, monterey bay, depth (water) 10m, sea water2019-01-16v4No1 / 21
433amnondominant sea water, ocean, depth (water) 4m, indian ocean2018-12-19v4No1 / 21
280amnondominant atlantic ocean, saline water, sea water, marine water body, depth (water) 20m, portuguese republic2018-01-25v4No1 / 21
505amnondominant water, pacific ocean, state of california, surface water, free floating, size < 1um, sea water2019-03-14v4No1 / 21
304amnondominant united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 21
485amnondominant depth (water) 20-100cm, water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth (water) 0-100cm, coast, sea water2019-02-19v4No1 / 23
222amnonhig hfreq. on outer biofilm on metal plate in ocean water (dominant biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 24
209amnondominant sea water, ocean, north america, depth (water) 25cm2017-10-15v4No1 / 26
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 36
362amnon high in active vent compared to inactive vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 37
642amnon high in water saline water sea water compared to marine sediment sediment in san diego pacific ocean 2020-08-28v4No1 / 56
9amnonhigher in sea water with coral ( high in porites astreoides compared to control in bermuda sea water )2016-10-27v4No1 / 61
317amnoncommon water, united states of america, state of california, pacific ocean, surface water, depth (water) 5m, sea water2018-04-15v4No1 / 62
642amnon high in chub mackerel scomber japonicus skin compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 67
9amnonhigher in beginning of experiment comapred to 12 days ( high in beginning compared to end in bermuda sea water )2016-10-27v4No1 / 71
483amnoncommon hawaii, pearl harbor, united states of america, water, sea water, depth 1-2m2019-02-13v4No1 / 72
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to sea water water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 77
807amnon high in autumn compared to summer in normal weather okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 78
136amnoncommon sea water, trichodesmium, ocean, sargasso sea, atlantic ocean2017-04-17v4No1 / 81
496amnon high in depth (water) 200m compared to depth (water) 100m in water canada saanich inlet pacific ocean sea water 2019-03-03v4No1 / 84
433amnon high in south china sea coast compared to indian ocean in sea water ocean depth (water) 4m 2018-12-19v4No1 / 87
9amnoncommon bermuda, sea water2016-10-27v4No1 / 91
676amnon high in spring compared to autumn summer in french republic sea water saline water english channel coastal waters of france water inlet 2028-02-27v4No1 / 94
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water size < 1um free floating sea water 2019-03-16v4No1 / 96
317amnoncommon depth (water) 150m, water, united states of america, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, sea water2018-04-15v4No1 / 101
676amnon high in autumn compared to spring summer in french republic sea water saline water english channel coastal waters of france water inlet 2028-02-27v4No1 / 102
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, north pacific ocean2017-04-17v4No1 / 103
642amnon high in saline water water sea water compared to chub mackerel scomber japonicus skin in san diego pacific ocean 2020-08-28v4No1 / 103
323amnonhigher in sharks compared to sea water ( high in shark compared to depth (water) 0cm water surface water sea water in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 107
461amnonearly colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, middle timepoints, sea water)2019-01-12v4No1 / 108
807amnon high in summer compared to autumn in normal weather okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 109
500amnonincreases when incubating water sample from depth 2100m at depth 0m for one year ( high in depth (water) 0cm late time points compared to early time points in depth (water) 2000-5000m water mediterranean sea depth (water) 2000-3000m sea water )2019-03-05v4No1 / 114
222amnoncommon water, sea water, guinea, depth (water) 3m2017-10-26v4No1 / 115
461amnonlate colonizers in chitin beads incubated in ocean water (other water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, chitin beads, late timepoints, sea water)2019-01-12v4No1 / 120
136amnoncommon sea water, trichodesmium, ocean, pacific ocean, south pacific ocean2017-04-17v4No1 / 125
362amnon high in inactive vent compared to active vent in hydrothermal vent greece marine sediment mediterranean sea marine hydrothermal vent volcanic rock volcanic crater water sea water 2018-08-29v4No1 / 129
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to depth (water) 0cm late time points in depth (water) 2000-5000m water mediterranean sea depth (water) 2000-3000m sea water )2019-03-05v4No1 / 132
280amnon high in marine water body sea water saline water compared to coral reef coral eunicella labiata gorgonian coral in atlantic ocean depth (water) 20m portuguese republic 2018-01-25v4No1 / 132
461amnonlower in early compared to late timepoints in chitin beads incubated in ocean water ( high in late timepoints compared to early timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 141
807amnoncommon normal weather, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 142
209amnon high in pacific ocean vancouver compared to atlantic ocean cape cod canal in sea water ocean north america depth (water) 25cm 2017-10-15v4No1 / 144
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
222amnoncommon on outer biofilm on metal plate in ocean water (common biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v4No1 / 147
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, active vent2018-08-29v4No1 / 150
9amnonhigher at end of experiment (grows at later times) ( high in end compared to beginning in bermuda sea water )2016-10-27v4No1 / 158
984amnoncommon depth (water) 0-20cm, surface water, sea water, pacific ocean, united states of america, state of california2022-12-26v4No1 / 159
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in water atlantic ocean surface water coastal water united states of america commonwealth of massachusetts chitin beads sea water )2019-01-12v4No1 / 160
342amnon high in surface water compared to depth (water) 150m depth (water) 300m in water pacific ocean philippine sea sea water 2018-05-28v4No1 / 161
209amnon high in cape cod canal atlantic ocean compared to vancouver pacific ocean in sea water ocean north america depth (water) 25cm 2017-10-15v4No1 / 166
222amnoncommon on inner biofilm on metal plate in ocean water (common biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal)2017-10-26v4No1 / 177
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
9amnonlower in sea water with coral ( high in control compared to porites astreoides in bermuda sea water )2016-10-27v4No1 / 211
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 10m, sea water2019-01-16v4No1 / 213
138amnoncommon in ocean water depth 5m (common ocean, pacific ocean, depth (water) 5m, sea water)2017-04-18v4No1 / 214
433amnoncommon sea water, ocean, depth (water) 4m, south china sea, coast2018-12-19v4No1 / 215
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 5m, sea water2019-01-16v4No1 / 220
505amnon high in early time points compared to late time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 223
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 20m, sea water2019-01-16v4No1 / 225
505amnoncommon water, pacific ocean, state of california, surface water, free floating, size < 1um, sea water2019-03-14v4No1 / 225
951amnon high in mirs bay compared to deep bay in depth (water) 20-100cm coast china surface water sea water 2022-12-08v3No1 / 236
342amnoncommon water, pacific ocean, philippine sea, surface water, sea water2018-05-28v4No1 / 236
342amnon high in depth (water) 150m depth (water) 300m compared to surface water in water pacific ocean philippine sea sea water 2018-05-28v4No1 / 239
807amnoncommon autumn, normal weather, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 240
308amnoncommon in water of aquarium with red abalone (common red abalone, haliotis rufescens, united states of america, state of california, research facility, water, sea water, aquarium)2018-03-30v4No1 / 240
485amnoncommon depth (water) 20-100cm, water, saline water, mediterranean sea, italy, gulf of naples, surface water, depth (water) 0-100cm, coast, sea water2019-02-19v4No1 / 244
965amnon high in sugar kelp saccharina latissima biofilm compared to sea water in state of connecticut united states of america atlantic ocean depth (water) 5-50m 2022-12-21v3No1 / 248
505amnon high in late time points compared to early time points in water pacific ocean state of california surface water size < 1um free floating sea water 2019-03-16v4No1 / 249
965amnoncommon sea water, state of connecticut, united states of america, atlantic ocean, depth (water) 5-50m2022-12-21v3No1 / 251
699amnoncommon united states of america, state of north carolina, state of south carolina, florida, atlantic ocean, saline water, sea water2028-04-01v4No1 / 254
970amnoncommon winter, depth (water) 0-20cm, surface water, newport river estuary, town of beaufort, united states of america, atlantic ocean, sea water2022-12-23v3No1 / 257
887amnoncommon australia, coral sea, great barrier reef, saline water, sea water2022-03-28v4No1 / 259
280amnoncommon atlantic ocean, saline water, sea water, marine water body, depth (water) 20m, portuguese republic2018-01-25v4No1 / 259
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 260
951amnoncommon mirs bay, depth (water) 20-100cm, coast, china, surface water, sea water2022-12-08v3No1 / 263
635amnoncommon hervey bay, surface water, sea water, australia2020-08-03v1No1 / 265
965amnon high in sea water compared to biofilm saccharina latissima sugar kelp in depth (water) 5-50m atlantic ocean united states of america state of connecticut 2022-12-21v3No1 / 277
355amnoncommon canada, province of british columbia, calvert island, pacific ocean, ocean, surface water, sea water2018-08-01v4No1 / 280
433amnon high in indian ocean compared to south china sea coast in sea water ocean depth (water) 4m 2018-12-19v4No1 / 283
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 283
496amnoncommon water, canada, saanich inlet, pacific ocean, depth (water) 200m, sea water2019-03-03v4No1 / 287
550amnoncommon city, hokkaido, sea water, japan2019-08-18v4No1 / 291
473amnon high in summer compared to winter in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 293
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 30m, sea water2019-01-16v4No1 / 293
722amnoncommon estuary, united states of america, state of new york, new york city, sea water, surface water2021-01-02v4No1 / 301
496amnon high in depth (water) 100m compared to depth (water) 200m in water canada saanich inlet pacific ocean sea water 2019-03-03v4No1 / 310
807amnonhigher during typhoon with red soil pollution compared to normal weather ( high in storm typhoon compared to normal weather in autumn near shore japan filtered 0.2um surface water okinawa islands sea water )2021-06-20v3No1 / 318
461amnoncommon water, atlantic ocean, surface water, coastal water, united states of america, commonwealth of massachusetts, sea water2019-01-12v4No1 / 322
342amnoncommon water, pacific ocean, philippine sea, depth (water) 300m, sea water2018-05-28v4No1 / 323
433amnoncommon sea water, ocean, depth (water) 4m, indian ocean2018-12-19v4No1 / 333
351amnoncommon in artificial sea water where sea urchins were grown (common sea urchin, lytechinus variegatus, research facility, state of florida, united states of america, artificial seawater, sea water)2018-07-30v4No1 / 338
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 40m, sea water2019-01-16v4No1 / 340
970amnoncommon summer, depth (water) 0-20cm, surface water, newport river estuary, town of beaufort, united states of america, atlantic ocean, sea water2022-12-23v3No1 / 341
93amnoncommon in seawater near the shore in hawaii (common hawaii, sea water, shore)2017-03-12v4No1 / 345
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth (water) 25cm in north america )2017-10-15v4No1 / 359
951amnoncommon in ocean water close to river outlet (common depth (water) 20-100cm, coast, deep bay, china, surface water, sea water)2022-12-08v3No1 / 372
550amnon high in sea water compared to starfish asterias amurensis coelomic fluid wild in city hokkaido japan 2019-08-18v4No1 / 389
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 60m, sea water2019-01-16v4No1 / 390
676amnoncommon water inlet, english channel coastal waters of france, saline water, sea water, french republic2028-02-27v4No1 / 390
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
342amnoncommon water, pacific ocean, philippine sea, depth (water) 150m, sea water2018-05-28v4No1 / 397
505amnoncommon water, pacific ocean, state of california, surface water, particle bound, size 1-80um, sea water2019-03-14v4No1 / 397
722amnon high in surface water sea water compared to sediment surface marine sediment sediment in estuary new york city state of new york united states of america 2021-01-02v4No1 / 399
676amnon high in cold water inlet compared to hot water inlet in water inlet english channel coastal waters of france saline water sea water french republic 2028-02-27v4No1 / 399
209amnoncommon sea water, ocean, north america, depth (water) 25cm2017-10-15v4No1 / 445
807amnoncommon storm, typhoon, autumn, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 447
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 80m, sea water2019-01-16v4No1 / 454
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
676amnoncommon aquarium, fish farm, french republic, sea water, saline water, english channel coastal waters of france2028-02-27v4No1 / 465
496amnoncommon water, canada, saanich inlet, pacific ocean, depth (water) 100m, sea water2019-03-03v4No1 / 469
951amnon high in deep bay compared to mirs bay in sea water surface water china coast depth (water) 20-100cm 2022-12-08v3No1 / 479
362amnoncommon hydrothermal vent, greece, marine sediment, mediterranean sea, marine hydrothermal vent, volcanic rock, volcanic crater, water, sea water, inactive vent2018-08-29v4No1 / 480
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 100m, sea water2019-01-16v4No1 / 486
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 200m, sea water2019-01-16v4No1 / 492
323amnoncommon depth (water) 0cm, depth (soil) 0-20cm, water, atlantic ocean, south florida, state of florida, united states of america, surface water, sea water2018-04-24v4No1 / 504
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth (water) 5m compared to depth (water) 300m depth (water) 150m depth (water) 75m in water united states of america state of california pacific ocean sea water )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in sea water water compared to sand in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 547
676amnon high in hot water inlet compared to cold water inlet in water inlet english channel coastal waters of france saline water sea water french republic 2028-02-27v4No1 / 551
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth (water) 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
138amnoncommon in ocean water depth 1000m (common sea water, ocean, pacific ocean, depth (water) 1000m)2017-04-18v4No1 / 566
138amnoncommon in ocean water depth 150-500m (common sea water, ocean, pacific ocean, depth (water) 150-500m)2017-04-18v4No1 / 582
473amnoncommon water, saline water, pacific ocean, state of california, monterey bay, depth (water) 500m, sea water2019-01-16v4No1 / 587
505amnon high in late time points compared to early time points in water pacific ocean state of california surface water particle bound size 1-80um sea water 2019-03-16v4No1 / 612
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, monterey bay2018-03-12v4No1 / 667
138amnoncommon in ocean water depth 2000-4000m (common sea water, ocean, pacific ocean, depth (water) 2000-4000m)2017-04-18v4No1 / 674
308amnoncommon in aquarium water with white abalone (common united states of america, state of california, research facility, haliotis sorenseni, white abalone, water, sea water, aquarium)2018-03-30v4No1 / 727
473amnon high in depth (water) 150-500m compared to depth (water) 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 870
317amnonhigher in depth>75m compared to depth >5m in ocean water ( high in depth (water) 300m depth (water) 75m depth (water) 150m compared to depth (water) 0cm surface water depth (water) 5m in water united states of america state of california pacific ocean sea water )2018-04-15v4No1 / 889
807amnoncommon tropical storm, summer, okinawa islands, japan, filtered 0.2um, near shore, sea water, surface water2021-06-20v3No1 / 905
473amnon high in depth (water) 5-50m compared to depth (water) 50-100m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 919
970amnon high in winter compared to summer in depth (water) 0-20cm surface water newport river estuary town of beaufort united states of america atlantic ocean sea water 2022-12-23v3No1 / 978
323amnonlower in sharks compared to sea water ( high in depth (water) 0cm water surface water sea water compared to shark in atlantic ocean south florida state of florida united states of america )2018-04-24v4No1 / 979
473amnon high in winter compared to summer in water saline water pacific ocean state of california monterey bay deth 5-100m sea water 2019-01-16v4No1 / 1006
473amnon high in depth (water) 50-100m compared to depth (water) 150-500m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1072
236amnoncommon ocean, state of california, pacific ocean, bodega bay, water, sea water2017-11-07v4No1 / 1156
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, san francisco bay2018-03-12v4No1 / 1166
807amnon high in tropical storm compared to normal weather in summer okinawa islands japan filtered 0.2um near shore sea water surface water 2021-06-20v3No1 / 1191
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water pacific ocean state of california surface water sea water 2019-03-14v4No1 / 1218
970amnon high in summer compared to winter in sea water atlantic ocean united states of america town of beaufort newport river estuary surface water depth (water) 0-20cm 2022-12-23v3No1 / 1298
304amnoncommon united states of america, state of california, beach, pacific ocean, water, sea water, santa cruz county2018-03-12v4No1 / 1425
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america state of california beach pacific ocean )2018-03-12v4No1 / 1599
473amnon high in depth (water) 50-100m compared to depth (water) 5-50m in water saline water pacific ocean state of california monterey bay sea water 2019-01-16v4No1 / 1656
722amnon high in sediment marine sediment sediment surface compared to sea water surface water in estuary united states of america state of new york new york city 2021-01-02v4No1 / 1736
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to air water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070
676amnon high in aquarium fish farm compared to water inlet in french republic sea water saline water english channel coastal waters of france 2028-02-27v4No1 / 3012
642amnon high in marine sediment sediment compared to saline water sea water water in san diego pacific ocean 2020-08-28v4No1 / 3217
676amnon high in fish farm aquarium compared to water inlet in french republic sea water saline water english channel coastal waters of france 2028-02-27v4No1 / 3729
676amnon high in biofilm saline water biofilm biofilm compared to saline water sea water in aquarium fish farm french republic english channel coastal waters of france 2028-02-27v4No1 / 3904
676amnon high in saline water sea water compared to biofilm saline water biofilm biofilm in aquarium fish farm french republic english channel coastal waters of france 2028-02-27v4No1 / 4350

Problems / suggestions? Please email info AT dbbact DOT org